Incidental Mutation 'R0801:Ccdc174'
ID76277
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Namecoiled-coil domain containing 174
Synonyms
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0801 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91878053-91899843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91895332 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 314 (E314G)
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037783
AA Change: E314G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083
AA Change: E314G

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ern2 A G 7: 122,180,862 probably benign Het
Ero1lb A G 13: 12,581,687 S123G probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Map2k5 T A 9: 63,357,979 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdga2 A T 12: 66,486,733 I878K probably damaging Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Olfr525 G A 7: 140,322,918 C73Y probably damaging Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Srgap1 A T 10: 121,807,875 F612L probably damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91880362 critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91898282 missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91899557 missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91890853 missense probably benign
R0482:Ccdc174 UTSW 6 91895266 missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91890892 splice site probably benign
R1124:Ccdc174 UTSW 6 91899580 missense probably benign 0.33
R1237:Ccdc174 UTSW 6 91890787 splice site probably benign
R1388:Ccdc174 UTSW 6 91881244 splice site probably null
R2176:Ccdc174 UTSW 6 91888089 missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91899357 missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91885356 nonsense probably null
R4775:Ccdc174 UTSW 6 91890894 splice site probably null
R4880:Ccdc174 UTSW 6 91899591 unclassified probably benign
R5579:Ccdc174 UTSW 6 91881350 splice site probably null
R5787:Ccdc174 UTSW 6 91881310 nonsense probably null
R5869:Ccdc174 UTSW 6 91885418 utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91880291 missense probably damaging 1.00
RF008:Ccdc174 UTSW 6 91899366 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGCTTCTACTGTGCTCTGTGAGTT -3'
(R):5'- TGAGAGTGTCATTCTGAAACATTCCAGC -3'

Sequencing Primer
(F):5'- cgccaccattgcctgtc -3'
(R):5'- tcacagagaaagcaaaaagcac -3'
Posted On2013-10-16