Mutagenetix > Incidental Mutations

Incidental Mutation 'R0801:Ern2'

76280

Institutional Source

Beutler Lab

Gene Symbol

Ern2

Ensembl Gene

ENSMUSG00000030866

Gene Name

endoplasmic reticulum (ER) to nucleus signalling 2

Synonyms

Ire1b

MMRRC Submission

038981-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R0801 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122169893-122186207 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 122180862 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]

Predicted Effect

probably benign
Transcript: ENSMUST00000033153

SMART Domains

Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
PQQ	33	64	5.5e-8	SMART
PQQ	115	147	4.7e-4	SMART
PQQ	148	180	6.1e-2	SMART
PQQ	192	223	6.2e-3	SMART
low complexity region	449	461	N/A	INTRINSIC
S_TKc	508	768	2.5e-11	SMART
PUG	831	888	9e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000206198

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.7%
3x: 99.2%
10x: 97.6%
20x: 94.7%

Validation Efficiency

98% (48/49)

MGI Phenotype

PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030612E09Rik	A	G	10: 43,174,991	K94E	possibly damaging	Het
Aldh16a1	A	T	7: 45,147,476	C228S	probably benign	Het
Arnt	G	T	3: 95,493,846	R702L	possibly damaging	Het
Ccdc174	A	G	6: 91,895,332	E314G	possibly damaging	Het
Ccdc81	T	C	7: 89,887,658		probably null	Het
Ccdc92	T	C	5: 124,836,271	T65A	probably benign	Het
Cenpm	A	T	15: 82,234,466	I149N	probably benign	Het
Cfap44	C	T	16: 44,422,486	S751L	probably benign	Het
Cntrl	A	G	2: 35,175,095		probably benign	Het
Col1a2	A	G	6: 4,531,316	T762A	unknown	Het
Crebbp	T	C	16: 4,088,276	K1621E	probably damaging	Het
Cux1	T	A	5: 136,326,929	I374L	probably damaging	Het
Dgkq	A	T	5: 108,660,720		probably null	Het
Dis3l	T	C	9: 64,319,154	I365V	probably benign	Het
Dock2	T	C	11: 34,708,793	R320G	probably damaging	Het
Dst	A	G	1: 34,170,389	N853S	probably damaging	Het
Egf	T	C	3: 129,702,585		probably benign	Het
Eif2ak2	T	A	17: 78,866,349	R267*	probably null	Het
Ero1lb	A	G	13: 12,581,687	S123G	probably benign	Het
Fam13a	G	T	6: 58,984,012	N118K	probably benign	Het
Gcn1l1	T	A	5: 115,591,006	M792K	probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Irf3	C	T	7: 45,000,634		probably benign	Het
Map2k5	T	A	9: 63,357,979		probably benign	Het
Mcf2l	T	A	8: 13,014,020		probably benign	Het
Mdga2	A	T	12: 66,486,733	I878K	probably damaging	Het
Mdn1	T	C	4: 32,668,895	S318P	probably benign	Het
Olfr1107	G	A	2: 87,072,063	Q24*	probably null	Het
Olfr525	G	A	7: 140,322,918	C73Y	probably damaging	Het
Pklr	G	A	3: 89,145,522	W527*	probably null	Het
Pnpla5	T	C	15: 84,113,920	M374V	probably benign	Het
Ptprn	G	T	1: 75,252,265	H835Q	probably damaging	Het
R3hdm4	A	G	10: 79,913,357		probably benign	Het
Rgs8	T	A	1: 153,670,811	C19S	probably damaging	Het
Smarca4	C	A	9: 21,642,554	Q575K	possibly damaging	Het
Srgap1	A	T	10: 121,807,875	F612L	probably damaging	Het
Svil	A	G	18: 5,099,443	R1256G	probably benign	Het
Tox4	T	C	14: 52,279,878	S22P	probably benign	Het
Ttc39d	A	G	17: 80,216,215	Y101C	probably damaging	Het
Usb1	T	C	8: 95,333,540		probably null	Het
Vps13a	T	C	19: 16,686,656		probably benign	Het
Vps26a	G	A	10: 62,459,078		probably benign	Het
Zfp638	T	A	6: 83,972,238		probably benign	Het

Other mutations in Ern2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01060:Ern2	APN	7	122170092	missense	probably damaging	0.99
IGL01324:Ern2	APN	7	122183190	missense	possibly damaging	0.88
IGL02185:Ern2	APN	7	122173375	splice site	probably benign
IGL02738:Ern2	APN	7	122182899	missense	probably damaging	0.99
IGL02750:Ern2	APN	7	122181406	splice site	probably benign
IGL03247:Ern2	APN	7	122171671	missense	probably benign	0.02
ernie	UTSW	7	122171661	critical splice donor site	probably null
Ernie2	UTSW	7	122180862	splice site	probably benign
ernie3	UTSW	7	122173819	critical splice acceptor site	probably null
R0165:Ern2	UTSW	7	122179779	missense	probably benign	0.02
R0785:Ern2	UTSW	7	122171661	critical splice donor site	probably null
R1345:Ern2	UTSW	7	122177770	missense	probably damaging	1.00
R1649:Ern2	UTSW	7	122177400	missense	probably damaging	1.00
R1747:Ern2	UTSW	7	122173819	critical splice acceptor site	probably null
R1747:Ern2	UTSW	7	122173820	critical splice acceptor site	probably null
R1846:Ern2	UTSW	7	122176536	missense	probably benign	0.32
R1899:Ern2	UTSW	7	122183842	splice site	probably benign
R1986:Ern2	UTSW	7	122171529	missense	probably benign	0.06
R2055:Ern2	UTSW	7	122183945	missense	possibly damaging	0.84
R2329:Ern2	UTSW	7	122173487	missense	possibly damaging	0.82
R2351:Ern2	UTSW	7	122171508	missense	probably damaging	0.97
R2894:Ern2	UTSW	7	122181587	missense	possibly damaging	0.94
R3176:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3276:Ern2	UTSW	7	122180964	missense	possibly damaging	0.89
R3945:Ern2	UTSW	7	122176530	missense	probably benign	0.10
R4303:Ern2	UTSW	7	122177846	critical splice acceptor site	probably null
R4874:Ern2	UTSW	7	122176587	missense	probably benign	0.28
R4943:Ern2	UTSW	7	122173258	missense	possibly damaging	0.95
R5184:Ern2	UTSW	7	122179959	missense	probably benign	0.03
R5629:Ern2	UTSW	7	122170166	missense	probably damaging	1.00
R5770:Ern2	UTSW	7	122179907	missense	possibly damaging	0.92
R6255:Ern2	UTSW	7	122173272	missense	probably damaging	1.00
R6272:Ern2	UTSW	7	122176646	missense	probably benign	0.05
R6277:Ern2	UTSW	7	122186107	missense	probably benign
R6624:Ern2	UTSW	7	122177783	missense	probably benign	0.00
R6940:Ern2	UTSW	7	122186146	missense	probably benign	0.01
R7491:Ern2	UTSW	7	122170533	missense	probably damaging	1.00
R7544:Ern2	UTSW	7	122173199	missense	probably benign	0.06
R7555:Ern2	UTSW	7	122170241	missense	probably damaging	1.00
R7843:Ern2	UTSW	7	122173708	missense	probably damaging	1.00
R8281:Ern2	UTSW	7	122170260	missense	probably damaging	1.00
R8321:Ern2	UTSW	7	122173208	missense	probably damaging	1.00
R8377:Ern2	UTSW	7	122181292	nonsense	probably null
R8548:Ern2	UTSW	7	122177839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGACAGGATTGAGCAGGGCATTAG -3'
(R):5'- TGGGTTTGGGAAGGACCACATGAC -3'

Sequencing Primer
(F):5'- TCCCTTAAGATGCAAGGGGTC -3'
(R):5'- CACATGACCATTCTCCTGGTAG -3'

Posted On

2013-10-16