Incidental Mutation 'R0801:Ern2'
ID76280
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 2
SynonymsIre1b
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0801 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122169893-122186207 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 122180862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000206198]
Predicted Effect probably benign
Transcript: ENSMUST00000033153
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206198
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc174 A G 6: 91,895,332 E314G possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ero1lb A G 13: 12,581,687 S123G probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Map2k5 T A 9: 63,357,979 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdga2 A T 12: 66,486,733 I878K probably damaging Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Olfr525 G A 7: 140,322,918 C73Y probably damaging Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Srgap1 A T 10: 121,807,875 F612L probably damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
ernie UTSW 7 122171661 critical splice donor site probably null
Ernie2 UTSW 7 122180862 splice site probably benign
ernie3 UTSW 7 122173819 critical splice acceptor site probably null
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R4943:Ern2 UTSW 7 122173258 missense possibly damaging 0.95
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6255:Ern2 UTSW 7 122173272 missense probably damaging 1.00
R6272:Ern2 UTSW 7 122176646 missense probably benign 0.05
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R6940:Ern2 UTSW 7 122186146 missense probably benign 0.01
R7491:Ern2 UTSW 7 122170533 missense probably damaging 1.00
R7544:Ern2 UTSW 7 122173199 missense probably benign 0.06
R7555:Ern2 UTSW 7 122170241 missense probably damaging 1.00
R7843:Ern2 UTSW 7 122173708 missense probably damaging 1.00
R8281:Ern2 UTSW 7 122170260 missense probably damaging 1.00
R8321:Ern2 UTSW 7 122173208 missense probably damaging 1.00
R8377:Ern2 UTSW 7 122181292 nonsense probably null
R8548:Ern2 UTSW 7 122177839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACAGGATTGAGCAGGGCATTAG -3'
(R):5'- TGGGTTTGGGAAGGACCACATGAC -3'

Sequencing Primer
(F):5'- TCCCTTAAGATGCAAGGGGTC -3'
(R):5'- CACATGACCATTCTCCTGGTAG -3'
Posted On2013-10-16