Incidental Mutation 'R0801:Olfr525'
ID76281
Institutional Source Beutler Lab
Gene Symbol Olfr525
Ensembl Gene ENSMUSG00000061489
Gene Nameolfactory receptor 525
SynonymsMOR251-2, GA_x6K02T2PBJ9-42472898-42473827
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0801 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140320858-140327625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140322918 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 73 (C73Y)
Ref Sequence ENSEMBL: ENSMUSP00000149361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078103] [ENSMUST00000214594]
Predicted Effect probably damaging
Transcript: ENSMUST00000078103
AA Change: C73Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077243
Gene: ENSMUSG00000061489
AA Change: C73Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 260 1.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214594
AA Change: C73Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215542
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc174 A G 6: 91,895,332 E314G possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ern2 A G 7: 122,180,862 probably benign Het
Ero1lb A G 13: 12,581,687 S123G probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Map2k5 T A 9: 63,357,979 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdga2 A T 12: 66,486,733 I878K probably damaging Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Srgap1 A T 10: 121,807,875 F612L probably damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Olfr525
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Olfr525 APN 7 140323592 nonsense probably null
IGL02450:Olfr525 APN 7 140323227 missense possibly damaging 0.95
IGL02927:Olfr525 APN 7 140322741 missense probably damaging 1.00
IGL03008:Olfr525 APN 7 140323532 missense probably damaging 1.00
IGL03202:Olfr525 APN 7 140323106 missense possibly damaging 0.96
R0268:Olfr525 UTSW 7 140323155 missense possibly damaging 0.63
R0612:Olfr525 UTSW 7 140323188 missense possibly damaging 0.63
R0751:Olfr525 UTSW 7 140323325 missense probably benign
R0940:Olfr525 UTSW 7 140323152 missense probably benign 0.01
R2220:Olfr525 UTSW 7 140323571 missense probably benign 0.03
R3748:Olfr525 UTSW 7 140323128 missense possibly damaging 0.87
R4660:Olfr525 UTSW 7 140323412 missense possibly damaging 0.67
R4683:Olfr525 UTSW 7 140322768 missense probably benign 0.01
R4887:Olfr525 UTSW 7 140323101 missense probably benign
R4919:Olfr525 UTSW 7 140323514 nonsense probably null
R5097:Olfr525 UTSW 7 140323095 missense probably damaging 1.00
R5836:Olfr525 UTSW 7 140322914 missense probably benign
R7024:Olfr525 UTSW 7 140322846 missense possibly damaging 0.75
R8242:Olfr525 UTSW 7 140322783 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATGATGGCTGCCTCACACCTG -3'
(R):5'- TGCACTGATGACCCACACACTG -3'

Sequencing Primer
(F):5'- TGTGTCACAGTAACTCCCAGG -3'
(R):5'- ATGGGCCAGCTCATCAGC -3'
Posted On2013-10-16