Incidental Mutation 'R0801:Map2k5'
ID76285
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0801 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 63357979 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034920
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216999
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc174 A G 6: 91,895,332 E314G possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ern2 A G 7: 122,180,862 probably benign Het
Ero1lb A G 13: 12,581,687 S123G probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdga2 A T 12: 66,486,733 I878K probably damaging Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Olfr525 G A 7: 140,322,918 C73Y probably damaging Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Srgap1 A T 10: 121,807,875 F612L probably damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5059:Map2k5 UTSW 9 63257014 missense probably benign 0.41
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8017:Map2k5 UTSW 9 63339121 missense probably damaging 0.98
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
R8247:Map2k5 UTSW 9 63371737 missense probably damaging 1.00
R8309:Map2k5 UTSW 9 63339079 critical splice donor site probably null
R8341:Map2k5 UTSW 9 63339098 missense probably damaging 1.00
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGCACCATACCTAATGCAAAAGTC -3'
(R):5'- TCACATGCACAGTGGATGGTAACC -3'

Sequencing Primer
(F):5'- ctcaccagctaggagcac -3'
(R):5'- GAGAATTCGAGTCTTACTGCTTTCA -3'
Posted On2013-10-16