Incidental Mutation 'R0804:Zfp773'
ID76313
Institutional Source Beutler Lab
Gene Symbol Zfp773
Ensembl Gene ENSMUSG00000063535
Gene Namezinc finger protein 773
Synonyms2810409K11Rik
MMRRC Submission 038984-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0804 (G1)
Quality Score109
Status Not validated
Chromosome7
Chromosomal Location7127073-7136755 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) AGCTGCTGCTGCTGCTGCTGCTGCTGC to AGCTGCTGCTGCTGCTGCTGCTGC at 7133093 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032622] [ENSMUST00000211240]
Predicted Effect probably benign
Transcript: ENSMUST00000032622
SMART Domains Protein: ENSMUSP00000032622
Gene: ENSMUSG00000063535

DomainStartEndE-ValueType
KRAB 75 134 6.82e-8 SMART
ZnF_C2H2 241 263 1.31e0 SMART
ZnF_C2H2 269 291 1.5e-4 SMART
ZnF_C2H2 297 319 4.17e-3 SMART
ZnF_C2H2 325 347 2.05e-2 SMART
ZnF_C2H2 353 375 2.24e-3 SMART
ZnF_C2H2 381 403 8.81e-2 SMART
ZnF_C2H2 409 431 7.26e-3 SMART
ZnF_C2H2 437 459 7.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211240
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in Zfp773
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Zfp773 APN 7 7132684 missense probably damaging 1.00
IGL00780:Zfp773 APN 7 7133114 missense probably benign 0.00
IGL01348:Zfp773 APN 7 7135315 missense possibly damaging 0.93
IGL02224:Zfp773 APN 7 7132976 missense probably benign 0.00
IGL02447:Zfp773 APN 7 7136656 utr 5 prime probably benign
IGL02869:Zfp773 APN 7 7134233 missense probably benign 0.22
R0505:Zfp773 UTSW 7 7133024 missense probably benign 0.03
R0585:Zfp773 UTSW 7 7132575 missense probably benign 0.21
R0846:Zfp773 UTSW 7 7132692 missense probably damaging 1.00
R1179:Zfp773 UTSW 7 7133093 intron probably benign
R2847:Zfp773 UTSW 7 7133093 intron probably benign
R3841:Zfp773 UTSW 7 7132391 missense possibly damaging 0.92
R4116:Zfp773 UTSW 7 7133093 intron probably benign
R4638:Zfp773 UTSW 7 7135336 missense probably damaging 1.00
R5126:Zfp773 UTSW 7 7136624 missense unknown
R6142:Zfp773 UTSW 7 7132482 missense probably benign 0.00
R7072:Zfp773 UTSW 7 7132875 missense probably benign 0.15
R7232:Zfp773 UTSW 7 7132985 missense probably benign 0.14
R7748:Zfp773 UTSW 7 7132908 missense probably benign 0.04
R7888:Zfp773 UTSW 7 7132979 missense probably benign 0.00
R7971:Zfp773 UTSW 7 7132979 missense probably benign 0.00
RF007:Zfp773 UTSW 7 7132690 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACATGATGCCTGTGAAGCCC -3'
(R):5'- TAAGGAAGGAAGTTCGGTCCCCAG -3'

Sequencing Primer
(F):5'- CCTGTGAAGCCCGGAGAG -3'
(R):5'- TCAGCCTCATCCCTGGAG -3'
Posted On2013-10-16