Incidental Mutation 'R0788:Cyp2t4'
ID76348
Institutional Source Beutler Lab
Gene Symbol Cyp2t4
Ensembl Gene ENSMUSG00000078787
Gene Namecytochrome P450, family 2, subfamily t, polypeptide 4
SynonymsLOC384724
MMRRC Submission 038968-MU
Accession Numbers

Genbank: NM_001100184; MGI: 2686296

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0788 (G1)
Quality Score206
Status Validated
Chromosome7
Chromosomal Location27153714-27158668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27155163 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 23 (M23V)
Ref Sequence ENSEMBL: ENSMUSP00000126779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000108382] [ENSMUST00000108385] [ENSMUST00000164093]
Predicted Effect probably benign
Transcript: ENSMUST00000080058
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108382
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108385
AA Change: M15V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104022
Gene: ENSMUSG00000078787
AA Change: M15V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 35 492 5.3e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152021
Predicted Effect probably null
Transcript: ENSMUST00000164093
AA Change: M23V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126779
Gene: ENSMUSG00000078787
AA Change: M23V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:p450 43 500 2.6e-130 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,473,932 Y380* probably null Het
4931406B18Rik C A 7: 43,499,199 S196I probably damaging Het
Ablim2 T C 5: 35,857,901 S519P probably benign Het
Adnp2 A C 18: 80,130,004 C397G probably benign Het
Aldh1l2 A G 10: 83,516,164 S156P probably damaging Het
Bcl2l15 G T 3: 103,833,478 probably null Het
Brd9 T A 13: 73,944,867 probably benign Het
Cars2 A C 8: 11,529,672 I262R possibly damaging Het
Ccdc106 T C 7: 5,057,534 probably benign Het
Cdh3 G A 8: 106,541,415 V361M probably benign Het
Cdhr1 A C 14: 37,087,375 probably null Het
Cdk5rap2 A G 4: 70,307,231 I559T possibly damaging Het
Cdkn2aip T A 8: 47,713,763 Q3L possibly damaging Het
Chd1 G T 17: 15,707,114 V10F possibly damaging Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Col6a4 T C 9: 106,071,998 K813E probably benign Het
Cttnbp2 G A 6: 18,423,835 T830I probably damaging Het
Cyp3a16 T C 5: 145,465,076 K59E probably benign Het
Dpysl5 G A 5: 30,788,841 probably null Het
E130308A19Rik T A 4: 59,719,847 Y460N possibly damaging Het
Ear6 T A 14: 51,854,030 C11* probably null Het
Fat1 C T 8: 45,023,983 T1999M probably benign Het
Gsdmd T A 15: 75,864,254 C77* probably null Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif28 A T 1: 179,705,223 probably benign Het
Krt6b A G 15: 101,677,519 I373T probably damaging Het
Lgr5 T C 10: 115,452,997 T509A probably damaging Het
Mapkbp1 C T 2: 120,024,001 P1354S probably benign Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncoa2 T C 1: 13,166,889 probably benign Het
Necap1 C T 6: 122,881,536 R113W probably damaging Het
Olfr365 T A 2: 37,202,023 Y261N possibly damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Per1 G A 11: 69,101,359 probably benign Het
Polb T C 8: 22,642,338 D130G probably null Het
Ppcs T C 4: 119,422,178 N59S probably damaging Het
Ppp2ca A G 11: 52,113,142 E42G possibly damaging Het
Ptprf T C 4: 118,226,466 T807A probably damaging Het
Rapgef2 A C 3: 79,099,195 F284V possibly damaging Het
Sestd1 A T 2: 77,191,716 F544I probably damaging Het
Slfn3 G A 11: 83,212,836 G178S possibly damaging Het
Supt6 G A 11: 78,207,772 probably benign Het
Tas2r109 T A 6: 132,980,301 Q222L probably benign Het
Tekt4 A C 17: 25,472,047 D109A probably damaging Het
Tob2 C A 15: 81,851,702 R22L probably damaging Het
Ttn T G 2: 76,822,938 E178D possibly damaging Het
Ube2u C A 4: 100,514,740 probably benign Het
Uggt2 A G 14: 119,095,400 probably benign Het
Vstm2a T C 11: 16,259,968 F65L probably damaging Het
Zfp57 A G 17: 37,006,200 probably benign Het
Znrf3 G T 11: 5,281,320 P731Q probably benign Het
Other mutations in Cyp2t4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2t4 APN 7 27155298 missense probably benign 0.00
IGL00706:Cyp2t4 APN 7 27155158 missense probably benign 0.01
IGL02926:Cyp2t4 APN 7 27157803 missense probably damaging 1.00
R0560:Cyp2t4 UTSW 7 27158511 missense probably damaging 0.99
R0632:Cyp2t4 UTSW 7 27158246 missense possibly damaging 0.82
R1353:Cyp2t4 UTSW 7 27156630 missense probably benign 0.03
R1652:Cyp2t4 UTSW 7 27157390 missense possibly damaging 0.48
R1838:Cyp2t4 UTSW 7 27158416 missense possibly damaging 0.92
R1997:Cyp2t4 UTSW 7 27157613 critical splice donor site probably null
R2136:Cyp2t4 UTSW 7 27158160 missense probably benign 0.32
R2963:Cyp2t4 UTSW 7 27155274 missense possibly damaging 0.86
R6239:Cyp2t4 UTSW 7 27157475 missense possibly damaging 0.73
R6634:Cyp2t4 UTSW 7 27155788 nonsense probably null
R7251:Cyp2t4 UTSW 7 27157719 missense possibly damaging 0.72
R7348:Cyp2t4 UTSW 7 27157251 missense probably benign 0.01
R7436:Cyp2t4 UTSW 7 27158243 missense probably damaging 0.99
R8350:Cyp2t4 UTSW 7 27157381 missense possibly damaging 0.51
R8352:Cyp2t4 UTSW 7 27157737 missense probably benign 0.04
Z1088:Cyp2t4 UTSW 7 27157746 missense probably damaging 1.00
Z1177:Cyp2t4 UTSW 7 27158240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCTCAAACTCTTGCACCTCCC -3'
(R):5'- AGGTCTAGTTCTAAACCGCCCCTC -3'

Sequencing Primer
(F):5'- TGCACCTCCCACACTAGTC -3'
(R):5'- GGCATCAGCTCTTAGACACAGG -3'
Posted On2013-10-16