Incidental Mutation 'R0788:4931406B18Rik'
ID76349
Institutional Source Beutler Lab
Gene Symbol 4931406B18Rik
Ensembl Gene ENSMUSG00000013353
Gene NameRIKEN cDNA 4931406B18 gene
Synonyms
MMRRC Submission 038968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0788 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43492044-43505940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 43499199 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 196 (S196I)
Ref Sequence ENSEMBL: ENSMUSP00000139468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013497] [ENSMUST00000163474] [ENSMUST00000163619] [ENSMUST00000168213] [ENSMUST00000168883] [ENSMUST00000171174] [ENSMUST00000191516]
Predicted Effect probably damaging
Transcript: ENSMUST00000013497
AA Change: S196I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013497
Gene: ENSMUSG00000013353
AA Change: S196I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:2ZG3|A 24 185 9e-7 PDB
Blast:IG_like 119 185 3e-19 BLAST
low complexity region 186 205 N/A INTRINSIC
SCOP:d1iray3 219 297 6e-3 SMART
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163474
SMART Domains Protein: ENSMUSP00000126619
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 111 3e-12 BLAST
SCOP:d1he7a_ 111 203 1e-3 SMART
Blast:IG_like 125 194 1e-5 BLAST
transmembrane domain 217 239 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163619
AA Change: S99I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131071
Gene: ENSMUSG00000013353
AA Change: S99I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
PDB:2ZG3|A 17 88 1e-5 PDB
Blast:IG_like 22 88 2e-21 BLAST
low complexity region 89 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168213
SMART Domains Protein: ENSMUSP00000129928
Gene: ENSMUSG00000013353

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG_like 23 119 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168636
Predicted Effect probably benign
Transcript: ENSMUST00000168883
Predicted Effect probably damaging
Transcript: ENSMUST00000171174
AA Change: S196I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129888
Gene: ENSMUSG00000013353
AA Change: S196I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191516
AA Change: S196I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139468
Gene: ENSMUSG00000013353
AA Change: S196I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_2 113 216 5.6e-3 PFAM
Pfam:Ig_2 200 297 7.7e-3 PFAM
transmembrane domain 311 333 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,473,932 Y380* probably null Het
Ablim2 T C 5: 35,857,901 S519P probably benign Het
Adnp2 A C 18: 80,130,004 C397G probably benign Het
Aldh1l2 A G 10: 83,516,164 S156P probably damaging Het
Bcl2l15 G T 3: 103,833,478 probably null Het
Brd9 T A 13: 73,944,867 probably benign Het
Cars2 A C 8: 11,529,672 I262R possibly damaging Het
Ccdc106 T C 7: 5,057,534 probably benign Het
Cdh3 G A 8: 106,541,415 V361M probably benign Het
Cdhr1 A C 14: 37,087,375 probably null Het
Cdk5rap2 A G 4: 70,307,231 I559T possibly damaging Het
Cdkn2aip T A 8: 47,713,763 Q3L possibly damaging Het
Chd1 G T 17: 15,707,114 V10F possibly damaging Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Col6a4 T C 9: 106,071,998 K813E probably benign Het
Cttnbp2 G A 6: 18,423,835 T830I probably damaging Het
Cyp2t4 A G 7: 27,155,163 M23V probably null Het
Cyp3a16 T C 5: 145,465,076 K59E probably benign Het
Dpysl5 G A 5: 30,788,841 probably null Het
E130308A19Rik T A 4: 59,719,847 Y460N possibly damaging Het
Ear6 T A 14: 51,854,030 C11* probably null Het
Fat1 C T 8: 45,023,983 T1999M probably benign Het
Gsdmd T A 15: 75,864,254 C77* probably null Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif28 A T 1: 179,705,223 probably benign Het
Krt6b A G 15: 101,677,519 I373T probably damaging Het
Lgr5 T C 10: 115,452,997 T509A probably damaging Het
Mapkbp1 C T 2: 120,024,001 P1354S probably benign Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncoa2 T C 1: 13,166,889 probably benign Het
Necap1 C T 6: 122,881,536 R113W probably damaging Het
Olfr365 T A 2: 37,202,023 Y261N possibly damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Per1 G A 11: 69,101,359 probably benign Het
Polb T C 8: 22,642,338 D130G probably null Het
Ppcs T C 4: 119,422,178 N59S probably damaging Het
Ppp2ca A G 11: 52,113,142 E42G possibly damaging Het
Ptprf T C 4: 118,226,466 T807A probably damaging Het
Rapgef2 A C 3: 79,099,195 F284V possibly damaging Het
Sestd1 A T 2: 77,191,716 F544I probably damaging Het
Slfn3 G A 11: 83,212,836 G178S possibly damaging Het
Supt6 G A 11: 78,207,772 probably benign Het
Tas2r109 T A 6: 132,980,301 Q222L probably benign Het
Tekt4 A C 17: 25,472,047 D109A probably damaging Het
Tob2 C A 15: 81,851,702 R22L probably damaging Het
Ttn T G 2: 76,822,938 E178D possibly damaging Het
Ube2u C A 4: 100,514,740 probably benign Het
Uggt2 A G 14: 119,095,400 probably benign Het
Vstm2a T C 11: 16,259,968 F65L probably damaging Het
Zfp57 A G 17: 37,006,200 probably benign Het
Znrf3 G T 11: 5,281,320 P731Q probably benign Het
Other mutations in 4931406B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:4931406B18Rik APN 7 43504175 splice site probably benign
IGL01902:4931406B18Rik APN 7 43497843 missense probably damaging 0.96
IGL02616:4931406B18Rik APN 7 43501013 splice site probably null
IGL02677:4931406B18Rik APN 7 43501095 nonsense probably null
IGL03030:4931406B18Rik APN 7 43495633 missense possibly damaging 0.62
R0007:4931406B18Rik UTSW 7 43498042 splice site probably benign
R1544:4931406B18Rik UTSW 7 43498119 missense possibly damaging 0.92
R2995:4931406B18Rik UTSW 7 43499368 missense probably damaging 1.00
R4656:4931406B18Rik UTSW 7 43501141 missense probably benign 0.20
R5595:4931406B18Rik UTSW 7 43497872 missense possibly damaging 0.92
R6288:4931406B18Rik UTSW 7 43498125 missense probably damaging 1.00
R6389:4931406B18Rik UTSW 7 43497830 missense possibly damaging 0.94
R6651:4931406B18Rik UTSW 7 43498072 missense possibly damaging 0.81
R6912:4931406B18Rik UTSW 7 43501147 missense possibly damaging 0.95
R7254:4931406B18Rik UTSW 7 43498199 missense probably damaging 0.99
R7615:4931406B18Rik UTSW 7 43497849 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACTTTGAGATCCAGAGGGCTTCTCC -3'
(R):5'- CCTGTGACTTTGAGCTGTACCATCC -3'

Sequencing Primer
(F):5'- TGGTGCTTGAAGTCCACAC -3'
(R):5'- TTTGAGCTGTACCATCCAAAGC -3'
Posted On2013-10-16