Incidental Mutation 'R0788:Aldh1l2'
ID76356
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Namealdehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission 038968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0788 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83487450-83534140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83516164 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
Predicted Effect probably damaging
Transcript: ENSMUST00000020497
AA Change: S269P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: S269P

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably damaging
Transcript: ENSMUST00000146640
AA Change: S156P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: S156P

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.8703 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,473,932 Y380* probably null Het
4931406B18Rik C A 7: 43,499,199 S196I probably damaging Het
Ablim2 T C 5: 35,857,901 S519P probably benign Het
Adnp2 A C 18: 80,130,004 C397G probably benign Het
Bcl2l15 G T 3: 103,833,478 probably null Het
Brd9 T A 13: 73,944,867 probably benign Het
Cars2 A C 8: 11,529,672 I262R possibly damaging Het
Ccdc106 T C 7: 5,057,534 probably benign Het
Cdh3 G A 8: 106,541,415 V361M probably benign Het
Cdhr1 A C 14: 37,087,375 probably null Het
Cdk5rap2 A G 4: 70,307,231 I559T possibly damaging Het
Cdkn2aip T A 8: 47,713,763 Q3L possibly damaging Het
Chd1 G T 17: 15,707,114 V10F possibly damaging Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Col6a4 T C 9: 106,071,998 K813E probably benign Het
Cttnbp2 G A 6: 18,423,835 T830I probably damaging Het
Cyp2t4 A G 7: 27,155,163 M23V probably null Het
Cyp3a16 T C 5: 145,465,076 K59E probably benign Het
Dpysl5 G A 5: 30,788,841 probably null Het
E130308A19Rik T A 4: 59,719,847 Y460N possibly damaging Het
Ear6 T A 14: 51,854,030 C11* probably null Het
Fat1 C T 8: 45,023,983 T1999M probably benign Het
Gsdmd T A 15: 75,864,254 C77* probably null Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif28 A T 1: 179,705,223 probably benign Het
Krt6b A G 15: 101,677,519 I373T probably damaging Het
Lgr5 T C 10: 115,452,997 T509A probably damaging Het
Mapkbp1 C T 2: 120,024,001 P1354S probably benign Het
Nat10 A G 2: 103,743,115 S346P probably damaging Het
Ncoa2 T C 1: 13,166,889 probably benign Het
Necap1 C T 6: 122,881,536 R113W probably damaging Het
Olfr365 T A 2: 37,202,023 Y261N possibly damaging Het
Orc4 A T 2: 48,937,467 V38E possibly damaging Het
Per1 G A 11: 69,101,359 probably benign Het
Polb T C 8: 22,642,338 D130G probably null Het
Ppcs T C 4: 119,422,178 N59S probably damaging Het
Ppp2ca A G 11: 52,113,142 E42G possibly damaging Het
Ptprf T C 4: 118,226,466 T807A probably damaging Het
Rapgef2 A C 3: 79,099,195 F284V possibly damaging Het
Sestd1 A T 2: 77,191,716 F544I probably damaging Het
Slfn3 G A 11: 83,212,836 G178S possibly damaging Het
Supt6 G A 11: 78,207,772 probably benign Het
Tas2r109 T A 6: 132,980,301 Q222L probably benign Het
Tekt4 A C 17: 25,472,047 D109A probably damaging Het
Tob2 C A 15: 81,851,702 R22L probably damaging Het
Ttn T G 2: 76,822,938 E178D possibly damaging Het
Ube2u C A 4: 100,514,740 probably benign Het
Uggt2 A G 14: 119,095,400 probably benign Het
Vstm2a T C 11: 16,259,968 F65L probably damaging Het
Zfp57 A G 17: 37,006,200 probably benign Het
Znrf3 G T 11: 5,281,320 P731Q probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGCTACAGGAAGCCATTCCC -3'
(R):5'- CCCCTGAGACTCTGGTCACACATTTAC -3'

Sequencing Primer
(F):5'- GCCATTCCCTAAAAACTGAGGTG -3'
(R):5'- CTCTGGTCACACATTTACAGAGATTC -3'
Posted On2013-10-16