Incidental Mutation 'R0788:Aldh1l2'
ID 76356
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 038968-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0788 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83352028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably damaging
Transcript: ENSMUST00000020497
AA Change: S269P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: S269P

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably damaging
Transcript: ENSMUST00000146640
AA Change: S156P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: S156P

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.8703 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,610,468 (GRCm39) Y380* probably null Het
4931406B18Rik C A 7: 43,148,623 (GRCm39) S196I probably damaging Het
Ablim2 T C 5: 36,015,245 (GRCm39) S519P probably benign Het
Adnp2 A C 18: 80,173,219 (GRCm39) C397G probably benign Het
Bcl2l15 G T 3: 103,740,794 (GRCm39) probably null Het
Brd9 T A 13: 74,092,986 (GRCm39) probably benign Het
Cars2 A C 8: 11,579,672 (GRCm39) I262R possibly damaging Het
Ccdc106 T C 7: 5,060,533 (GRCm39) probably benign Het
Cdh3 G A 8: 107,268,047 (GRCm39) V361M probably benign Het
Cdhr1 A C 14: 36,809,332 (GRCm39) probably null Het
Cdk5rap2 A G 4: 70,225,468 (GRCm39) I559T possibly damaging Het
Cdkn2aip T A 8: 48,166,798 (GRCm39) Q3L possibly damaging Het
Chd1 G T 17: 15,927,376 (GRCm39) V10F possibly damaging Het
Col4a4 G A 1: 82,502,717 (GRCm39) P356S unknown Het
Col6a4 T C 9: 105,949,197 (GRCm39) K813E probably benign Het
Cttnbp2 G A 6: 18,423,834 (GRCm39) T830I probably damaging Het
Cyp2t4 A G 7: 26,854,588 (GRCm39) M23V probably null Het
Cyp3a16 T C 5: 145,401,886 (GRCm39) K59E probably benign Het
Dpysl5 G A 5: 30,946,185 (GRCm39) probably null Het
E130308A19Rik T A 4: 59,719,847 (GRCm39) Y460N possibly damaging Het
Ear6 T A 14: 52,091,487 (GRCm39) C11* probably null Het
Fat1 C T 8: 45,477,020 (GRCm39) T1999M probably benign Het
Gsdmd T A 15: 75,736,103 (GRCm39) C77* probably null Het
Hsp90ab1 ACTTCTT ACTT 17: 45,880,425 (GRCm39) probably benign Het
Kif28 A T 1: 179,532,788 (GRCm39) probably benign Het
Krt6b A G 15: 101,585,954 (GRCm39) I373T probably damaging Het
Lgr5 T C 10: 115,288,902 (GRCm39) T509A probably damaging Het
Mapkbp1 C T 2: 119,854,482 (GRCm39) P1354S probably benign Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncoa2 T C 1: 13,237,113 (GRCm39) probably benign Het
Necap1 C T 6: 122,858,495 (GRCm39) R113W probably damaging Het
Or1l4 T A 2: 37,092,035 (GRCm39) Y261N possibly damaging Het
Orc4 A T 2: 48,827,479 (GRCm39) V38E possibly damaging Het
Per1 G A 11: 68,992,185 (GRCm39) probably benign Het
Polb T C 8: 23,132,354 (GRCm39) D130G probably null Het
Ppcs T C 4: 119,279,375 (GRCm39) N59S probably damaging Het
Ppp2ca A G 11: 52,003,969 (GRCm39) E42G possibly damaging Het
Ptprf T C 4: 118,083,663 (GRCm39) T807A probably damaging Het
Rapgef2 A C 3: 79,006,502 (GRCm39) F284V possibly damaging Het
Sestd1 A T 2: 77,022,060 (GRCm39) F544I probably damaging Het
Slfn3 G A 11: 83,103,662 (GRCm39) G178S possibly damaging Het
Supt6 G A 11: 78,098,598 (GRCm39) probably benign Het
Tas2r109 T A 6: 132,957,264 (GRCm39) Q222L probably benign Het
Tekt4 A C 17: 25,691,021 (GRCm39) D109A probably damaging Het
Tob2 C A 15: 81,735,903 (GRCm39) R22L probably damaging Het
Ttn T G 2: 76,653,282 (GRCm39) E178D possibly damaging Het
Ube2u C A 4: 100,371,937 (GRCm39) probably benign Het
Uggt2 A G 14: 119,332,812 (GRCm39) probably benign Het
Vstm2a T C 11: 16,209,968 (GRCm39) F65L probably damaging Het
Zfp57 A G 17: 37,317,092 (GRCm39) probably benign Het
Znrf3 G T 11: 5,231,320 (GRCm39) P731Q probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTGCTACAGGAAGCCATTCCC -3'
(R):5'- CCCCTGAGACTCTGGTCACACATTTAC -3'

Sequencing Primer
(F):5'- GCCATTCCCTAAAAACTGAGGTG -3'
(R):5'- CTCTGGTCACACATTTACAGAGATTC -3'
Posted On 2013-10-16