Incidental Mutation 'R0789:Tsga10'
ID76377
Institutional Source Beutler Lab
Gene Symbol Tsga10
Ensembl Gene ENSMUSG00000060771
Gene Nametestis specific 10
Synonyms4933432N21Rik, Mtsga10
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0789 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37754776-37866429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37801787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 446 (I446N)
Ref Sequence ENSEMBL: ENSMUSP00000110552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041815] [ENSMUST00000088072] [ENSMUST00000114902] [ENSMUST00000151735]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041815
AA Change: I446N

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048859
Gene: ENSMUSG00000060771
AA Change: I446N

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000088072
AA Change: I446N

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085391
Gene: ENSMUSG00000060771
AA Change: I446N

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114902
AA Change: I446N

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110552
Gene: ENSMUSG00000060771
AA Change: I446N

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151735
SMART Domains Protein: ENSMUSP00000120554
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 229 N/A INTRINSIC
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Ccdc33 C T 9: 58,117,214 probably benign Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Flt1 C T 5: 147,639,483 E572K probably damaging Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Klk1b8 A C 7: 43,945,727 probably benign Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr1111 T C 2: 87,149,827 Y278C probably damaging Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Wdr17 A T 8: 54,659,572 probably benign Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Znrd1as T C 17: 36,964,960 Y145H probably damaging Het
Other mutations in Tsga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tsga10 APN 1 37807070 missense probably damaging 0.99
IGL00579:Tsga10 APN 1 37835453 missense probably damaging 1.00
IGL00837:Tsga10 APN 1 37801911 splice site probably benign
IGL01577:Tsga10 APN 1 37835457 missense possibly damaging 0.85
IGL01727:Tsga10 APN 1 37835274 missense probably damaging 1.00
IGL02037:Tsga10 APN 1 37807017 missense probably benign 0.05
IGL02510:Tsga10 APN 1 37760985 missense possibly damaging 0.89
R0346:Tsga10 UTSW 1 37840519 missense possibly damaging 0.65
R0961:Tsga10 UTSW 1 37761428 critical splice donor site probably null
R1370:Tsga10 UTSW 1 37835453 missense probably damaging 1.00
R1440:Tsga10 UTSW 1 37819599 missense probably damaging 1.00
R1827:Tsga10 UTSW 1 37835580 missense probably damaging 1.00
R2504:Tsga10 UTSW 1 37815677 missense probably damaging 1.00
R3104:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3105:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3106:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3824:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R3825:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R4560:Tsga10 UTSW 1 37807082 missense probably benign 0.00
R4773:Tsga10 UTSW 1 37835525 missense probably damaging 1.00
R4927:Tsga10 UTSW 1 37801850 missense probably damaging 1.00
R5036:Tsga10 UTSW 1 37783968 missense possibly damaging 0.65
R5326:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5345:Tsga10 UTSW 1 37763311 missense probably damaging 1.00
R5503:Tsga10 UTSW 1 37760947 makesense probably null
R5542:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5793:Tsga10 UTSW 1 37835459 missense probably damaging 1.00
R6340:Tsga10 UTSW 1 37835185 intron probably benign
R7096:Tsga10 UTSW 1 37840614 missense probably damaging 0.98
R7130:Tsga10 UTSW 1 37783884 missense probably damaging 1.00
R7401:Tsga10 UTSW 1 37834187 missense probably null 1.00
R7649:Tsga10 UTSW 1 37835148 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGATTGACATTATGTTGAGCCAAGCC -3'
(R):5'- CTGCTGAGTGAGGAACTGATGGAC -3'

Sequencing Primer
(F):5'- AGCCAAGCTCACTTAGTATGAC -3'
(R):5'- GATTTCCCAGTGGCCTAGATAGC -3'
Posted On2013-10-16