Incidental Mutation 'R0789:Olfr1111'
ID76384
Institutional Source Beutler Lab
Gene Symbol Olfr1111
Ensembl Gene ENSMUSG00000075158
Gene Nameolfactory receptor 1111
SynonymsMOR181-2, GA_x6K02T2Q125-48635468-48634530
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R0789 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87149181-87152624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87149827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 278 (Y278C)
Ref Sequence ENSEMBL: ENSMUSP00000150760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099860] [ENSMUST00000214492] [ENSMUST00000216378]
Predicted Effect probably damaging
Transcript: ENSMUST00000099860
AA Change: Y278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097446
Gene: ENSMUSG00000075158
AA Change: Y278C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-54 PFAM
Pfam:7tm_1 41 290 7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214492
AA Change: Y278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216378
AA Change: Y278C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5131 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Ccdc33 C T 9: 58,117,214 probably benign Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Flt1 C T 5: 147,639,483 E572K probably damaging Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Klk1b8 A C 7: 43,945,727 probably benign Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Tsga10 A T 1: 37,801,787 I446N possibly damaging Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Wdr17 A T 8: 54,659,572 probably benign Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Znrd1as T C 17: 36,964,960 Y145H probably damaging Het
Other mutations in Olfr1111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Olfr1111 APN 2 87149825 missense possibly damaging 0.53
IGL02217:Olfr1111 APN 2 87149887 missense probably benign 0.00
R1437:Olfr1111 UTSW 2 87149771 missense possibly damaging 0.94
R1696:Olfr1111 UTSW 2 87150380 missense probably benign 0.00
R1700:Olfr1111 UTSW 2 87149779 missense probably damaging 1.00
R1717:Olfr1111 UTSW 2 87149806 nonsense probably null
R4965:Olfr1111 UTSW 2 87150659 start codon destroyed possibly damaging 0.89
R5221:Olfr1111 UTSW 2 87150481 missense probably damaging 1.00
R5297:Olfr1111 UTSW 2 87150449 missense probably benign 0.01
R5837:Olfr1111 UTSW 2 87150355 missense probably benign 0.02
R6544:Olfr1111 UTSW 2 87149863 missense probably damaging 1.00
R6911:Olfr1111 UTSW 2 87149767 missense probably damaging 1.00
R8537:Olfr1111 UTSW 2 87150038 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGGAGTGGAAAATTCTATGGTGAGTGT -3'
(R):5'- AGCATCAAGTCCACAGGAGGCA -3'

Sequencing Primer
(F):5'- agctgcaaagaatatgaaaaagaag -3'
(R):5'- AGGAGCAAAACATTTTCCACTTGTG -3'
Posted On2013-10-16