Incidental Mutation 'R0789:Flt1'
ID76390
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0789 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147639483 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 572 (E572K)
Ref Sequence ENSEMBL: ENSMUSP00000106158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031653
AA Change: E572K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: E572K

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110529
AA Change: E572K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: E572K

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Ccdc33 C T 9: 58,117,214 probably benign Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Klk1b8 A C 7: 43,945,727 probably benign Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr1111 T C 2: 87,149,827 Y278C probably damaging Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Tsga10 A T 1: 37,801,787 I446N possibly damaging Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Wdr17 A T 8: 54,659,572 probably benign Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Znrd1as T C 17: 36,964,960 Y145H probably damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCAGTGCTCACCTCTAACGAGAAC -3'
(R):5'- TGCTCCTGCTGAGAGAATCCAAATG -3'

Sequencing Primer
(F):5'- AACGAGAACTTCTGTCTTCCG -3'
(R):5'- TGCTGAGAGAATCCAAATGTGAATAC -3'
Posted On2013-10-16