Incidental Mutation 'R0789:Wdr17'
ID76396
Institutional Source Beutler Lab
Gene Symbol Wdr17
Ensembl Gene ENSMUSG00000039375
Gene NameWD repeat domain 17
SynonymsB230207L18Rik, 3010002I12Rik
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0789 (G1)
Quality Score216
Status Validated
Chromosome8
Chromosomal Location54629055-54887184 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 54659572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127511] [ENSMUST00000144711] [ENSMUST00000150488] [ENSMUST00000175915]
Predicted Effect probably benign
Transcript: ENSMUST00000127511
SMART Domains Protein: ENSMUSP00000115550
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 162 202 1.58e2 SMART
WD40 205 252 4.26e1 SMART
WD40 255 298 1.15e0 SMART
WD40 383 422 1.59e-7 SMART
WD40 425 465 2.39e0 SMART
WD40 468 509 5.52e-2 SMART
WD40 511 550 4.14e-6 SMART
WD40 555 595 5.14e-11 SMART
WD40 598 638 6.58e-9 SMART
WD40 641 681 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144711
SMART Domains Protein: ENSMUSP00000117710
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 194 235 7.64e1 SMART
WD40 238 281 1.15e0 SMART
WD40 366 405 1.59e-7 SMART
WD40 408 448 2.39e0 SMART
WD40 451 492 5.52e-2 SMART
WD40 494 533 4.14e-6 SMART
WD40 538 578 5.14e-11 SMART
WD40 581 621 6.58e-9 SMART
WD40 624 664 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150488
SMART Domains Protein: ENSMUSP00000122326
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175915
SMART Domains Protein: ENSMUSP00000135805
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Ccdc33 C T 9: 58,117,214 probably benign Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Flt1 C T 5: 147,639,483 E572K probably damaging Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Klk1b8 A C 7: 43,945,727 probably benign Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr1111 T C 2: 87,149,827 Y278C probably damaging Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Tsga10 A T 1: 37,801,787 I446N possibly damaging Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Znrd1as T C 17: 36,964,960 Y145H probably damaging Het
Other mutations in Wdr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Wdr17 APN 8 54687711 missense probably damaging 1.00
IGL00496:Wdr17 APN 8 54659579 splice site probably benign
IGL01318:Wdr17 APN 8 54672550 missense probably damaging 1.00
IGL01347:Wdr17 APN 8 54651345 missense probably benign
IGL01654:Wdr17 APN 8 54662879 missense probably damaging 1.00
IGL02010:Wdr17 APN 8 54659703 missense probably damaging 0.97
IGL02085:Wdr17 APN 8 54687736 nonsense probably null
IGL02205:Wdr17 APN 8 54696300 missense probably damaging 1.00
IGL02375:Wdr17 APN 8 54696388 missense possibly damaging 0.94
IGL02705:Wdr17 APN 8 54648215 splice site probably null
IGL02719:Wdr17 APN 8 54693054 splice site probably null
IGL03051:Wdr17 APN 8 54651314 missense probably damaging 0.99
IGL03131:Wdr17 APN 8 54696267 critical splice donor site probably null
IGL03172:Wdr17 APN 8 54661480 missense probably damaging 0.96
enthralled UTSW 8 54659681 missense possibly damaging 0.85
riveted UTSW 8 54632487 missense probably benign 0.00
thrilled UTSW 8 54696268 critical splice donor site probably null
IGL03138:Wdr17 UTSW 8 54649143 missense probably damaging 1.00
PIT4458001:Wdr17 UTSW 8 54673579 nonsense probably null
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0124:Wdr17 UTSW 8 54635491 missense probably damaging 1.00
R0226:Wdr17 UTSW 8 54663008 missense probably benign 0.08
R0270:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0271:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0288:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0321:Wdr17 UTSW 8 54696268 critical splice donor site probably null
R0464:Wdr17 UTSW 8 54670392 splice site probably benign
R0479:Wdr17 UTSW 8 54651421 splice site probably null
R0488:Wdr17 UTSW 8 54693052 unclassified probably benign
R0552:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0553:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0600:Wdr17 UTSW 8 54661495 missense probably damaging 1.00
R0621:Wdr17 UTSW 8 54643191 missense probably benign 0.18
R0655:Wdr17 UTSW 8 54649198 missense probably damaging 1.00
R0730:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0854:Wdr17 UTSW 8 54703881 missense probably benign
R0879:Wdr17 UTSW 8 54661481 missense probably benign 0.08
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1497:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R1589:Wdr17 UTSW 8 54703907 intron probably benign
R1618:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R1768:Wdr17 UTSW 8 54673654 missense possibly damaging 0.84
R1778:Wdr17 UTSW 8 54690214 missense probably damaging 1.00
R1819:Wdr17 UTSW 8 54690124 missense probably benign 0.18
R1913:Wdr17 UTSW 8 54687726 missense probably damaging 1.00
R2129:Wdr17 UTSW 8 54632381 missense probably damaging 1.00
R2132:Wdr17 UTSW 8 54672506 missense probably damaging 1.00
R2309:Wdr17 UTSW 8 54643248 missense probably benign
R3882:Wdr17 UTSW 8 54639501 missense possibly damaging 0.53
R4097:Wdr17 UTSW 8 54635469 missense probably damaging 1.00
R4372:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R4380:Wdr17 UTSW 8 54648407 intron probably benign
R4480:Wdr17 UTSW 8 54664964 critical splice donor site probably null
R4654:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4656:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4669:Wdr17 UTSW 8 54690048 missense possibly damaging 0.72
R4719:Wdr17 UTSW 8 54639876 missense probably benign 0.33
R4912:Wdr17 UTSW 8 54629861 missense probably damaging 1.00
R5000:Wdr17 UTSW 8 54665126 missense possibly damaging 0.82
R5073:Wdr17 UTSW 8 54690236 critical splice acceptor site probably null
R5176:Wdr17 UTSW 8 54653878 critical splice donor site probably null
R5194:Wdr17 UTSW 8 54687604 missense probably damaging 1.00
R5270:Wdr17 UTSW 8 54643186 missense probably benign 0.20
R5300:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5325:Wdr17 UTSW 8 54659681 missense possibly damaging 0.85
R5336:Wdr17 UTSW 8 54632318 missense probably damaging 1.00
R5394:Wdr17 UTSW 8 54639489 missense possibly damaging 0.73
R5424:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5425:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5426:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5548:Wdr17 UTSW 8 54703851 missense probably damaging 0.97
R5681:Wdr17 UTSW 8 54662869 missense probably damaging 1.00
R5722:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R5894:Wdr17 UTSW 8 54696300 missense probably damaging 1.00
R5906:Wdr17 UTSW 8 54639468 missense probably benign 0.33
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6391:Wdr17 UTSW 8 54661460 missense probably benign 0.04
R6605:Wdr17 UTSW 8 54681524 missense probably benign 0.16
R6892:Wdr17 UTSW 8 54673596 missense probably damaging 1.00
R7019:Wdr17 UTSW 8 54681453 missense probably damaging 1.00
R7257:Wdr17 UTSW 8 54632487 missense probably benign 0.00
R7481:Wdr17 UTSW 8 54661336 missense probably benign
R7868:Wdr17 UTSW 8 54696267 critical splice donor site probably null
R7939:Wdr17 UTSW 8 54687642 missense probably damaging 0.98
R7962:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R8017:Wdr17 UTSW 8 54638368 missense possibly damaging 0.73
R8122:Wdr17 UTSW 8 54664976 missense probably damaging 1.00
R8226:Wdr17 UTSW 8 54693120 missense possibly damaging 0.52
R8251:Wdr17 UTSW 8 54657232 missense probably damaging 1.00
R8413:Wdr17 UTSW 8 54662918 missense probably benign 0.08
R8534:Wdr17 UTSW 8 54648230 missense probably benign 0.08
R8708:Wdr17 UTSW 8 54640092 intron probably benign
V5088:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
X0022:Wdr17 UTSW 8 54639494 missense probably benign 0.04
X0066:Wdr17 UTSW 8 54673560 missense probably damaging 1.00
Z1177:Wdr17 UTSW 8 54643185 missense probably benign 0.03
Z1177:Wdr17 UTSW 8 54670379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTAGTCCAGAGACCCCACTTTAC -3'
(R):5'- TCTGGGACAATGAGACAGACCTCTTC -3'

Sequencing Primer
(F):5'- AGAGACCCCACTTTACTGTTTCTG -3'
(R):5'- ggatggagaaatgactcagagg -3'
Posted On2013-10-16