Incidental Mutation 'R0789:Ccdc33'
ID76399
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Namecoiled-coil domain containing 33
SynonymsLOC382077, 4930535E21Rik
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0789 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58028677-58118823 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 58117214 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098681] [ENSMUST00000098682] [ENSMUST00000128021] [ENSMUST00000136154] [ENSMUST00000215944]
Predicted Effect probably benign
Transcript: ENSMUST00000098681
Predicted Effect probably benign
Transcript: ENSMUST00000098682
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131007
Predicted Effect probably benign
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146741
Predicted Effect probably benign
Transcript: ENSMUST00000215944
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Flt1 C T 5: 147,639,483 E572K probably damaging Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Klk1b8 A C 7: 43,945,727 probably benign Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr1111 T C 2: 87,149,827 Y278C probably damaging Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Tsga10 A T 1: 37,801,787 I446N possibly damaging Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Wdr17 A T 8: 54,659,572 probably benign Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Znrd1as T C 17: 36,964,960 Y145H probably damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 58082048 missense probably damaging 0.99
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 intron probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GACCCCTTTCAGAGCCTTCATGAC -3'
(R):5'- TACAGTGTGGCCTTCCATGTGC -3'

Sequencing Primer
(F):5'- GCCTTCATGACAGTGTCAAG -3'
(R):5'- TGTCTCAGACTGTCAACTGG -3'
Posted On2013-10-16