Incidental Mutation 'R0789:Znrd1as'
ID76418
Institutional Source Beutler Lab
Gene Symbol Znrd1as
Ensembl Gene ENSMUSG00000036214
Gene Namezinc ribbon domain containing 1, antisense
Synonyms1700022C21Rik
MMRRC Submission 038969-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R0789 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36958592-36965625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36964960 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 145 (Y145H)
Ref Sequence ENSEMBL: ENSMUSP00000147556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040177] [ENSMUST00000173814] [ENSMUST00000209623]
Predicted Effect probably damaging
Transcript: ENSMUST00000040177
AA Change: Y75H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048695
Gene: ENSMUSG00000036214
AA Change: Y75H

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
coiled coil region 163 195 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172672
Predicted Effect probably benign
Transcript: ENSMUST00000173814
SMART Domains Protein: ENSMUSP00000134016
Gene: ENSMUSG00000036214

DomainStartEndE-ValueType
low complexity region 19 36 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
low complexity region 145 157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185085
Predicted Effect probably damaging
Transcript: ENSMUST00000209623
AA Change: Y145H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.7%
  • 20x: 91.7%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik G T 7: 140,248,220 G114W probably damaging Het
Asb10 T C 5: 24,539,864 T111A probably damaging Het
BC024139 T C 15: 76,121,083 I526M possibly damaging Het
Cacnb4 C T 2: 52,451,883 V335I probably damaging Het
Ccdc33 C T 9: 58,117,214 probably benign Het
Cfap58 T G 19: 47,955,309 I316S probably benign Het
Chpf A T 1: 75,475,763 L349Q probably damaging Het
Cntnap1 A G 11: 101,181,384 probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Dnah1 T C 14: 31,304,591 I777V probably benign Het
Dnah11 A G 12: 117,911,232 V3966A probably damaging Het
Fbxo38 G A 18: 62,515,499 S656F possibly damaging Het
Fgf10 T A 13: 118,789,205 N173K probably benign Het
Flt1 C T 5: 147,639,483 E572K probably damaging Het
Gabra6 C A 11: 42,315,017 R336S probably benign Het
Glt8d2 T C 10: 82,664,685 N77S probably damaging Het
Grem1 C A 2: 113,749,711 K148N probably benign Het
Hat1 G A 2: 71,421,744 probably benign Het
Hydin A T 8: 110,566,971 I3517F possibly damaging Het
Immt A G 6: 71,861,067 K253R probably damaging Het
Klk1b8 A C 7: 43,945,727 probably benign Het
Krt39 T C 11: 99,521,062 Y66C probably benign Het
Mrgprb1 T C 7: 48,456,184 probably benign Het
Nrp2 A G 1: 62,745,450 M253V probably benign Het
Olfr1111 T C 2: 87,149,827 Y278C probably damaging Het
Olfr851 C A 9: 19,497,162 P138H possibly damaging Het
Omt2b G T 9: 78,328,165 probably benign Het
Pcdh20 T C 14: 88,468,790 Y358C probably damaging Het
Pik3r4 T C 9: 105,685,167 M1215T probably benign Het
Rasal2 T C 1: 157,157,321 E927G probably damaging Het
Ryr3 A G 2: 112,780,973 probably null Het
Scaf8 T C 17: 3,196,837 C812R possibly damaging Het
Smpd4 T C 16: 17,625,826 V78A probably benign Het
Sp2 A T 11: 96,961,376 S241T probably benign Het
Tsga10 A T 1: 37,801,787 I446N possibly damaging Het
Ubr4 G A 4: 139,410,271 probably null Het
Usp44 T C 10: 93,847,220 probably benign Het
Usp54 A T 14: 20,562,157 S864T probably benign Het
Vmn2r56 A G 7: 12,732,835 Y91H probably damaging Het
Vmn2r96 T C 17: 18,582,476 V216A possibly damaging Het
Wdr17 A T 8: 54,659,572 probably benign Het
Zmym6 A G 4: 127,122,822 T799A possibly damaging Het
Other mutations in Znrd1as
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Znrd1as APN 17 36964921 missense probably damaging 0.99
R0347:Znrd1as UTSW 17 36965315 missense probably damaging 1.00
R0993:Znrd1as UTSW 17 36965047 small deletion probably benign
R2110:Znrd1as UTSW 17 36965444 missense possibly damaging 0.47
R2866:Znrd1as UTSW 17 36965160 missense possibly damaging 0.91
R4224:Znrd1as UTSW 17 36958725 utr 5 prime probably benign
R4746:Znrd1as UTSW 17 36964873 missense probably benign 0.00
R7449:Znrd1as UTSW 17 36964383 missense probably damaging 1.00
RF005:Znrd1as UTSW 17 36965048 small insertion probably benign
RF008:Znrd1as UTSW 17 36965054 small insertion probably benign
RF010:Znrd1as UTSW 17 36965063 small insertion probably benign
RF014:Znrd1as UTSW 17 36965060 small insertion probably benign
RF024:Znrd1as UTSW 17 36965057 small insertion probably benign
RF025:Znrd1as UTSW 17 36965048 small insertion probably benign
RF029:Znrd1as UTSW 17 36965071 small insertion probably benign
RF035:Znrd1as UTSW 17 36965066 small insertion probably benign
RF046:Znrd1as UTSW 17 36965057 small insertion probably benign
RF048:Znrd1as UTSW 17 36965059 small insertion probably benign
RF053:Znrd1as UTSW 17 36965066 small insertion probably benign
RF064:Znrd1as UTSW 17 36965050 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCAGCACAGGTGACCCTTTG -3'
(R):5'- TCAGGCACCCAGTAATGCTGTTTC -3'

Sequencing Primer
(F):5'- CTCCTTATACTTGTACTGGAGAAGGC -3'
(R):5'- ACCCAGTAATGCTGTTTCTGTCTC -3'
Posted On2013-10-16