Incidental Mutation 'R0790:Ccdc150'
ID76421
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Namecoiled-coil domain containing 150
Synonyms4930511H11Rik
MMRRC Submission 038970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0790 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54250683-54368727 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 54277776 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
Predicted Effect probably benign
Transcript: ENSMUST00000027128
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161988
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.0%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A G 12: 8,010,245 E2876G probably damaging Het
Arhgef28 A G 13: 97,981,406 S585P possibly damaging Het
Atp11b T A 3: 35,832,923 N685K probably damaging Het
Camsap2 C T 1: 136,273,737 probably benign Het
Cdc23 A G 18: 34,651,613 I32T possibly damaging Het
Cdca2 C T 14: 67,680,291 D553N probably benign Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Chit1 T G 1: 134,138,752 V2G probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Cpsf4l A G 11: 113,706,408 probably benign Het
Etaa1 G T 11: 17,946,051 Q689K probably benign Het
Fam83h C T 15: 76,003,392 V699I probably benign Het
Fry A G 5: 150,466,437 D2545G probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif5a T C 10: 127,246,009 probably benign Het
Lifr A G 15: 7,185,715 T768A probably benign Het
Mrap2 T C 9: 87,182,782 L192P possibly damaging Het
Myo18a G A 11: 77,840,709 R840Q possibly damaging Het
Myrfl T C 10: 116,817,788 D458G probably damaging Het
Olfr533 T C 7: 140,467,049 S283P possibly damaging Het
Olfr571 A G 7: 102,909,636 Y68H probably benign Het
Pcdh15 A G 10: 74,631,053 E1034G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcb2 G A 2: 118,712,483 probably benign Het
Psmd1 T C 1: 86,077,450 V202A possibly damaging Het
Raet1d T C 10: 22,370,896 I41T probably damaging Het
Retnlb T A 16: 48,817,226 L5Q possibly damaging Het
Sh3rf1 T C 8: 61,329,258 Y145H probably damaging Het
Smad7 C T 18: 75,393,862 H260Y probably benign Het
Stk10 T C 11: 32,598,653 V407A probably benign Het
Synpo A G 18: 60,603,503 V218A probably damaging Het
Tll2 T A 19: 41,103,850 Y499F probably damaging Het
Vrk1 C T 12: 106,070,624 P390S probably benign Het
Zfp748 A C 13: 67,545,362 L64W probably benign Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54272550 splice site probably benign
IGL00819:Ccdc150 APN 1 54263573 missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54300488 splice site probably null
IGL02352:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54272521 missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54263545 nonsense probably null
IGL02673:Ccdc150 APN 1 54328990 missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54278715 missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54300323 missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54290702 missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0066:Ccdc150 UTSW 1 54356691 missense probably benign
R0217:Ccdc150 UTSW 1 54300430 missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54329511 missense probably benign
R0687:Ccdc150 UTSW 1 54285631 splice site probably null
R1146:Ccdc150 UTSW 1 54364971 splice site probably benign
R1288:Ccdc150 UTSW 1 54364458 missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54354636 missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54367910 intron probably benign
R1957:Ccdc150 UTSW 1 54263909 missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54272547 critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54364925 missense probably null 0.11
R3054:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54288842 missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54356773 missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54368310 missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54278811 missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54353054 missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54355754 missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54278715 missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54364868 intron probably benign
R5028:Ccdc150 UTSW 1 54263477 missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54354647 missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54263620 missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54300367 missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54277714 missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54285628 critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54263599 missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54368017 missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54263957 splice site probably null
R6988:Ccdc150 UTSW 1 54355709 nonsense probably null
R7248:Ccdc150 UTSW 1 54304898 missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54263337 intron probably null
R7322:Ccdc150 UTSW 1 54259966 missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54300382 nonsense probably null
R7647:Ccdc150 UTSW 1 54356704 missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54272497 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGCTGACAAACCTTGTAAACTGC -3'
(R):5'- TGCCTCTATAAGACCTGTGACAGACC -3'

Sequencing Primer
(F):5'- AACCTTGTAAACTGCCATGCTG -3'
(R):5'- tgtgacagacccagttttcc -3'
Posted On2013-10-16