Incidental Mutation 'R0790:Chit1'
ID76424
Institutional Source Beutler Lab
Gene Symbol Chit1
Ensembl Gene ENSMUSG00000026450
Gene Namechitinase 1 (chitotriosidase)
Synonyms
MMRRC Submission 038970-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0790 (G1)
Quality Score178
Status Validated
Chromosome1
Chromosomal Location134111242-134151540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 134138752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 2 (V2G)
Ref Sequence ENSEMBL: ENSMUSP00000124331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086475] [ENSMUST00000159963] [ENSMUST00000160060]
Predicted Effect probably benign
Transcript: ENSMUST00000086475
AA Change: V2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083666
Gene: ENSMUSG00000026450
AA Change: V2G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159963
AA Change: V2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123979
Gene: ENSMUSG00000026450
AA Change: V2G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 361 6.69e-151 SMART
ChtBD2 416 464 5.56e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160060
AA Change: V2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124331
Gene: ENSMUSG00000026450
AA Change: V2G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 354 2.47e-131 SMART
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced pulmonary fibrosis induced by bleomycin or IL13 expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A G 12: 8,010,245 E2876G probably damaging Het
Arhgef28 A G 13: 97,981,406 S585P possibly damaging Het
Atp11b T A 3: 35,832,923 N685K probably damaging Het
Camsap2 C T 1: 136,273,737 probably benign Het
Ccdc150 T A 1: 54,277,776 probably benign Het
Cdc23 A G 18: 34,651,613 I32T possibly damaging Het
Cdca2 C T 14: 67,680,291 D553N probably benign Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Cpsf4l A G 11: 113,706,408 probably benign Het
Etaa1 G T 11: 17,946,051 Q689K probably benign Het
Fam83h C T 15: 76,003,392 V699I probably benign Het
Fry A G 5: 150,466,437 D2545G probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif5a T C 10: 127,246,009 probably benign Het
Lifr A G 15: 7,185,715 T768A probably benign Het
Mrap2 T C 9: 87,182,782 L192P possibly damaging Het
Myo18a G A 11: 77,840,709 R840Q possibly damaging Het
Myrfl T C 10: 116,817,788 D458G probably damaging Het
Olfr533 T C 7: 140,467,049 S283P possibly damaging Het
Olfr571 A G 7: 102,909,636 Y68H probably benign Het
Pcdh15 A G 10: 74,631,053 E1034G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcb2 G A 2: 118,712,483 probably benign Het
Psmd1 T C 1: 86,077,450 V202A possibly damaging Het
Raet1d T C 10: 22,370,896 I41T probably damaging Het
Retnlb T A 16: 48,817,226 L5Q possibly damaging Het
Sh3rf1 T C 8: 61,329,258 Y145H probably damaging Het
Smad7 C T 18: 75,393,862 H260Y probably benign Het
Stk10 T C 11: 32,598,653 V407A probably benign Het
Synpo A G 18: 60,603,503 V218A probably damaging Het
Tll2 T A 19: 41,103,850 Y499F probably damaging Het
Vrk1 C T 12: 106,070,624 P390S probably benign Het
Zfp748 A C 13: 67,545,362 L64W probably benign Het
Other mutations in Chit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Chit1 APN 1 134145254 missense probably damaging 1.00
IGL01344:Chit1 APN 1 134151314 missense probably damaging 1.00
IGL01352:Chit1 APN 1 134148490 missense probably damaging 1.00
IGL01620:Chit1 APN 1 134150519 missense probably damaging 1.00
IGL01795:Chit1 APN 1 134148429 missense probably damaging 1.00
IGL01924:Chit1 APN 1 134149410 missense probably benign 0.05
IGL02000:Chit1 APN 1 134146675 missense probably benign 0.01
IGL02891:Chit1 APN 1 134145310 missense probably benign 0.38
Debt UTSW 1 134149425 missense probably null 1.00
R0838:Chit1 UTSW 1 134143337 nonsense probably null
R1783:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1783:Chit1 UTSW 1 134149395 missense probably benign 0.03
R1784:Chit1 UTSW 1 134149394 missense possibly damaging 0.67
R1863:Chit1 UTSW 1 134151250 missense probably damaging 0.96
R1940:Chit1 UTSW 1 134145418 critical splice donor site probably null
R1950:Chit1 UTSW 1 134151230 missense probably damaging 1.00
R2045:Chit1 UTSW 1 134151144 missense probably benign 0.05
R2260:Chit1 UTSW 1 134151127 missense probably benign
R4552:Chit1 UTSW 1 134144051 missense probably benign 0.17
R5386:Chit1 UTSW 1 134149454 missense probably damaging 1.00
R5975:Chit1 UTSW 1 134146626 missense probably damaging 1.00
R6134:Chit1 UTSW 1 134144060 missense possibly damaging 0.94
R6196:Chit1 UTSW 1 134146643 nonsense probably null
R6482:Chit1 UTSW 1 134143242 missense probably damaging 0.98
R6923:Chit1 UTSW 1 134149425 missense probably null 1.00
R6952:Chit1 UTSW 1 134143284 missense probably damaging 1.00
R7022:Chit1 UTSW 1 134151292 missense probably benign 0.44
R7198:Chit1 UTSW 1 134150491 missense possibly damaging 0.87
R8079:Chit1 UTSW 1 134144027 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGTTGCCAAAGACCACTGTGTCG -3'
(R):5'- AGCCCTTGAGCTGAAAACAGCC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctctctc -3'
(R):5'- CAGCCAAGCCAGGAGTCAG -3'
Posted On2013-10-16