Incidental Mutation 'R0790:Plcb2'
ID76426
Institutional Source Beutler Lab
Gene Symbol Plcb2
Ensembl Gene ENSMUSG00000040061
Gene Namephospholipase C, beta 2
SynonymsB230205M18Rik
MMRRC Submission 038970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0790 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location118707517-118728438 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 118712483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102524] [ENSMUST00000159756]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000006415
Predicted Effect probably benign
Transcript: ENSMUST00000102524
SMART Domains Protein: ENSMUSP00000099583
Gene: ENSMUSG00000040061

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 220 311 2.5e-24 PFAM
PLCXc 312 463 2.87e-79 SMART
low complexity region 504 518 N/A INTRINSIC
PLCYc 547 663 2.39e-67 SMART
C2 684 783 9.17e-15 SMART
low complexity region 902 925 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
Pfam:PLC-beta_C 974 1149 4.7e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129153
Predicted Effect probably benign
Transcript: ENSMUST00000159756
SMART Domains Protein: ENSMUSP00000124364
Gene: ENSMUSG00000040061

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:EF-hand_like 197 288 7.1e-26 PFAM
PLCXc 289 440 2.87e-79 SMART
low complexity region 481 495 N/A INTRINSIC
PLCYc 524 640 2.39e-67 SMART
C2 661 760 9.17e-15 SMART
low complexity region 879 902 N/A INTRINSIC
low complexity region 906 917 N/A INTRINSIC
Pfam:PLC-beta_C 946 1129 5.1e-68 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphodiesterase that catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate to the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol. The encoded protein is activated by G proteins and has been shown to be involved in the type 2 taste receptor signal transduction pathway. In addition, nuclear factor kappa B can regulate the transcription of this gene, whose protein product is also an important regulator of platelet responses. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant mice showed an increased sensitivity to both bacterial and viral infections and exhibited abnormal taste perception in which sweet, umami, and bitter stimuli could not be sensed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A G 12: 8,010,245 E2876G probably damaging Het
Arhgef28 A G 13: 97,981,406 S585P possibly damaging Het
Atp11b T A 3: 35,832,923 N685K probably damaging Het
Camsap2 C T 1: 136,273,737 probably benign Het
Ccdc150 T A 1: 54,277,776 probably benign Het
Cdc23 A G 18: 34,651,613 I32T possibly damaging Het
Cdca2 C T 14: 67,680,291 D553N probably benign Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Chit1 T G 1: 134,138,752 V2G probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Cpsf4l A G 11: 113,706,408 probably benign Het
Etaa1 G T 11: 17,946,051 Q689K probably benign Het
Fam83h C T 15: 76,003,392 V699I probably benign Het
Fry A G 5: 150,466,437 D2545G probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif5a T C 10: 127,246,009 probably benign Het
Lifr A G 15: 7,185,715 T768A probably benign Het
Mrap2 T C 9: 87,182,782 L192P possibly damaging Het
Myo18a G A 11: 77,840,709 R840Q possibly damaging Het
Myrfl T C 10: 116,817,788 D458G probably damaging Het
Olfr533 T C 7: 140,467,049 S283P possibly damaging Het
Olfr571 A G 7: 102,909,636 Y68H probably benign Het
Pcdh15 A G 10: 74,631,053 E1034G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Psmd1 T C 1: 86,077,450 V202A possibly damaging Het
Raet1d T C 10: 22,370,896 I41T probably damaging Het
Retnlb T A 16: 48,817,226 L5Q possibly damaging Het
Sh3rf1 T C 8: 61,329,258 Y145H probably damaging Het
Smad7 C T 18: 75,393,862 H260Y probably benign Het
Stk10 T C 11: 32,598,653 V407A probably benign Het
Synpo A G 18: 60,603,503 V218A probably damaging Het
Tll2 T A 19: 41,103,850 Y499F probably damaging Het
Vrk1 C T 12: 106,070,624 P390S probably benign Het
Zfp748 A C 13: 67,545,362 L64W probably benign Het
Other mutations in Plcb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Plcb2 APN 2 118718889 missense probably damaging 1.00
IGL00715:Plcb2 APN 2 118713734 critical splice donor site probably null
IGL00851:Plcb2 APN 2 118728251 missense probably benign 0.30
IGL01765:Plcb2 APN 2 118710268 splice site probably benign
IGL01837:Plcb2 APN 2 118711926 splice site probably null
IGL01868:Plcb2 APN 2 118709590 missense probably damaging 1.00
IGL01868:Plcb2 APN 2 118711387 missense probably benign 0.09
IGL02158:Plcb2 APN 2 118711363 missense probably benign 0.06
IGL02447:Plcb2 APN 2 118713155 missense probably damaging 1.00
IGL02490:Plcb2 APN 2 118719760 missense probably damaging 0.99
IGL02691:Plcb2 APN 2 118710963 missense probably benign 0.00
IGL02723:Plcb2 APN 2 118717019 splice site probably benign
IGL02929:Plcb2 APN 2 118713234 splice site probably benign
IGL02949:Plcb2 APN 2 118719109 splice site probably null
PIT4480001:Plcb2 UTSW 2 118723496 missense probably benign 0.00
R0031:Plcb2 UTSW 2 118715461 missense probably benign 0.36
R0157:Plcb2 UTSW 2 118718541 missense probably damaging 0.98
R0366:Plcb2 UTSW 2 118724447 missense probably benign 0.01
R0376:Plcb2 UTSW 2 118717240 missense probably damaging 0.99
R0570:Plcb2 UTSW 2 118717325 missense probably benign 0.32
R0893:Plcb2 UTSW 2 118725105 splice site probably benign
R1647:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1648:Plcb2 UTSW 2 118723780 missense possibly damaging 0.51
R1686:Plcb2 UTSW 2 118715687 splice site probably benign
R2210:Plcb2 UTSW 2 118717503 missense probably damaging 1.00
R2211:Plcb2 UTSW 2 118723534 missense probably benign 0.05
R2251:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2252:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2253:Plcb2 UTSW 2 118723765 missense probably benign 0.10
R2426:Plcb2 UTSW 2 118715649 missense probably damaging 1.00
R3970:Plcb2 UTSW 2 118715690 splice site probably benign
R4007:Plcb2 UTSW 2 118710793 missense probably damaging 1.00
R4162:Plcb2 UTSW 2 118709587 missense probably damaging 1.00
R4236:Plcb2 UTSW 2 118709566 missense probably damaging 1.00
R4422:Plcb2 UTSW 2 118712003 missense probably benign 0.28
R4772:Plcb2 UTSW 2 118713134 missense probably benign 0.20
R4795:Plcb2 UTSW 2 118711124 missense probably benign 0.32
R4935:Plcb2 UTSW 2 118718915 missense probably damaging 1.00
R5019:Plcb2 UTSW 2 118712136 missense probably benign 0.01
R5055:Plcb2 UTSW 2 118718222 missense probably benign 0.06
R5452:Plcb2 UTSW 2 118718246 missense probably damaging 0.98
R5622:Plcb2 UTSW 2 118714729 missense probably damaging 1.00
R5752:Plcb2 UTSW 2 118711051 intron probably benign
R6284:Plcb2 UTSW 2 118717301 missense probably benign 0.37
R6380:Plcb2 UTSW 2 118715468 missense probably damaging 1.00
R6574:Plcb2 UTSW 2 118719173 missense probably damaging 0.99
R6728:Plcb2 UTSW 2 118723690 missense probably damaging 1.00
R6792:Plcb2 UTSW 2 118719441 missense probably damaging 1.00
R7529:Plcb2 UTSW 2 118710234 missense probably damaging 1.00
R7560:Plcb2 UTSW 2 118715643 missense probably damaging 0.99
R7610:Plcb2 UTSW 2 118719759 missense possibly damaging 0.86
R7760:Plcb2 UTSW 2 118711388 missense probably benign
R8152:Plcb2 UTSW 2 118710821 missense probably benign 0.22
R8170:Plcb2 UTSW 2 118711453 missense possibly damaging 0.68
R8413:Plcb2 UTSW 2 118718823 missense probably damaging 1.00
R8913:Plcb2 UTSW 2 118713884 missense probably damaging 1.00
X0024:Plcb2 UTSW 2 118712375 missense probably benign 0.13
Z1176:Plcb2 UTSW 2 118723128 missense probably damaging 0.99
Z1177:Plcb2 UTSW 2 118709200 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACGGACTTCTTATCCTGGGCATTG -3'
(R):5'- GCCCATGATCTTCTGGAGTCACTG -3'

Sequencing Primer
(F):5'- GCTACTGTAAGATCTGGGAACAC -3'
(R):5'- agacacttgctgctaagcc -3'
Posted On2013-10-16