Incidental Mutation 'R0790:Pirb'
ID76430
Institutional Source Beutler Lab
Gene Symbol Pirb
Ensembl Gene ENSMUSG00000058818
Gene Namepaired Ig-like receptor B
SynonymsLilrb3, Gp91
MMRRC Submission 038970-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0790 (G1)
Quality Score105
Status Not validated
Chromosome7
Chromosomal Location3711409-3720391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3717638 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 287 (L287Q)
Ref Sequence ENSEMBL: ENSMUSP00000077546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078451]
Predicted Effect probably benign
Transcript: ENSMUST00000078451
AA Change: L287Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: L287Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 118 1.8e-3 SMART
IG 129 315 1.2e-4 SMART
IG_like 237 302 6.2e-4 SMART
IG_like 328 415 3.4e-2 SMART
IG_like 435 502 1e-2 SMART
IG 529 618 3.6e-5 SMART
low complexity region 624 637 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155131
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.0%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A G 12: 8,010,245 E2876G probably damaging Het
Arhgef28 A G 13: 97,981,406 S585P possibly damaging Het
Atp11b T A 3: 35,832,923 N685K probably damaging Het
Camsap2 C T 1: 136,273,737 probably benign Het
Ccdc150 T A 1: 54,277,776 probably benign Het
Cdc23 A G 18: 34,651,613 I32T possibly damaging Het
Cdca2 C T 14: 67,680,291 D553N probably benign Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Chit1 T G 1: 134,138,752 V2G probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Cpsf4l A G 11: 113,706,408 probably benign Het
Etaa1 G T 11: 17,946,051 Q689K probably benign Het
Fam83h C T 15: 76,003,392 V699I probably benign Het
Fry A G 5: 150,466,437 D2545G probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif5a T C 10: 127,246,009 probably benign Het
Lifr A G 15: 7,185,715 T768A probably benign Het
Mrap2 T C 9: 87,182,782 L192P possibly damaging Het
Myo18a G A 11: 77,840,709 R840Q possibly damaging Het
Myrfl T C 10: 116,817,788 D458G probably damaging Het
Olfr533 T C 7: 140,467,049 S283P possibly damaging Het
Olfr571 A G 7: 102,909,636 Y68H probably benign Het
Pcdh15 A G 10: 74,631,053 E1034G probably benign Het
Plcb2 G A 2: 118,712,483 probably benign Het
Psmd1 T C 1: 86,077,450 V202A possibly damaging Het
Raet1d T C 10: 22,370,896 I41T probably damaging Het
Retnlb T A 16: 48,817,226 L5Q possibly damaging Het
Sh3rf1 T C 8: 61,329,258 Y145H probably damaging Het
Smad7 C T 18: 75,393,862 H260Y probably benign Het
Stk10 T C 11: 32,598,653 V407A probably benign Het
Synpo A G 18: 60,603,503 V218A probably damaging Het
Tll2 T A 19: 41,103,850 Y499F probably damaging Het
Vrk1 C T 12: 106,070,624 P390S probably benign Het
Zfp748 A C 13: 67,545,362 L64W probably benign Het
Other mutations in Pirb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pirb APN 7 3717406 missense probably damaging 0.99
IGL01744:Pirb APN 7 3717176 nonsense probably null
IGL01755:Pirb APN 7 3717170 missense probably benign 0.16
IGL02580:Pirb APN 7 3714206 splice site probably null
IGL02941:Pirb APN 7 3717378 missense probably damaging 1.00
R0394:Pirb UTSW 7 3719248 missense probably benign 0.08
R0680:Pirb UTSW 7 3717361 missense possibly damaging 0.94
R0787:Pirb UTSW 7 3717638 missense probably benign
R0832:Pirb UTSW 7 3717638 missense probably benign
R1124:Pirb UTSW 7 3719732 missense probably benign 0.02
R1178:Pirb UTSW 7 3717638 missense probably benign
R1180:Pirb UTSW 7 3717638 missense probably benign
R1181:Pirb UTSW 7 3717638 missense probably benign
R1281:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1343:Pirb UTSW 7 3717638 missense probably benign
R1579:Pirb UTSW 7 3717638 missense probably benign
R1699:Pirb UTSW 7 3717638 missense probably benign
R1768:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1909:Pirb UTSW 7 3714588 missense probably benign 0.33
R1965:Pirb UTSW 7 3717638 missense probably benign
R1966:Pirb UTSW 7 3717638 missense probably benign
R2004:Pirb UTSW 7 3717638 missense probably benign
R2305:Pirb UTSW 7 3712991 missense probably benign 0.00
R2931:Pirb UTSW 7 3717206 missense probably benign 0.08
R3858:Pirb UTSW 7 3717663 missense possibly damaging 0.54
R3928:Pirb UTSW 7 3717638 missense probably benign
R3938:Pirb UTSW 7 3717638 missense probably benign
R4119:Pirb UTSW 7 3717575 missense probably damaging 1.00
R4174:Pirb UTSW 7 3716032 critical splice donor site probably null
R4248:Pirb UTSW 7 3719298 missense probably damaging 1.00
R4827:Pirb UTSW 7 3717603 missense probably benign
R4828:Pirb UTSW 7 3717603 missense probably benign
R4829:Pirb UTSW 7 3717603 missense probably benign
R4830:Pirb UTSW 7 3717603 missense probably benign
R4870:Pirb UTSW 7 3712662 missense probably benign 0.00
R4909:Pirb UTSW 7 3719362 nonsense probably null
R5146:Pirb UTSW 7 3712621 utr 3 prime probably benign
R5244:Pirb UTSW 7 3716063 missense probably benign 0.32
R5323:Pirb UTSW 7 3716599 missense possibly damaging 0.85
R5921:Pirb UTSW 7 3716694 nonsense probably null
R6316:Pirb UTSW 7 3717823 missense probably damaging 1.00
R6502:Pirb UTSW 7 3717393 missense probably benign 0.00
R6811:Pirb UTSW 7 3719642 missense possibly damaging 0.91
R7216:Pirb UTSW 7 3716274 missense probably benign 0.00
R7275:Pirb UTSW 7 3716178 missense probably benign 0.00
R7327:Pirb UTSW 7 3717188 nonsense probably null
R7582:Pirb UTSW 7 3713818 critical splice donor site probably null
R7717:Pirb UTSW 7 3717783 missense not run
R7717:Pirb UTSW 7 3717801 missense not run
R7807:Pirb UTSW 7 3719865 missense possibly damaging 0.55
R7844:Pirb UTSW 7 3719411 nonsense probably null
R7927:Pirb UTSW 7 3719411 nonsense probably null
R8206:Pirb UTSW 7 3712906 critical splice donor site probably null
X0025:Pirb UTSW 7 3717268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCGTAACATCTGAATGCCCCTG -3'
(R):5'- TCTGGGCCACTTTCCAACACAC -3'

Sequencing Primer
(F):5'- TCCTATAATAAACAGGGCTCGG -3'
(R):5'- ACCATCAAGGCTGAACCAGG -3'
Posted On2013-10-16