Incidental Mutation 'R0790:Vrk1'
ID76445
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
MMRRC Submission 038970-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R0790 (G1)
Quality Score214
Status Validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106070624 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 390 (P390S)
Ref Sequence ENSEMBL: ENSMUSP00000152721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
Predicted Effect probably benign
Transcript: ENSMUST00000021539
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072040
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085026
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220629
Predicted Effect probably benign
Transcript: ENSMUST00000221312
AA Change: P390S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apob A G 12: 8,010,245 E2876G probably damaging Het
Arhgef28 A G 13: 97,981,406 S585P possibly damaging Het
Atp11b T A 3: 35,832,923 N685K probably damaging Het
Camsap2 C T 1: 136,273,737 probably benign Het
Ccdc150 T A 1: 54,277,776 probably benign Het
Cdc23 A G 18: 34,651,613 I32T possibly damaging Het
Cdca2 C T 14: 67,680,291 D553N probably benign Het
Chd8 T C 14: 52,204,025 D870G probably benign Het
Chit1 T G 1: 134,138,752 V2G probably benign Het
Col4a4 G A 1: 82,524,996 P356S unknown Het
Cpsf4l A G 11: 113,706,408 probably benign Het
Etaa1 G T 11: 17,946,051 Q689K probably benign Het
Fam83h C T 15: 76,003,392 V699I probably benign Het
Fry A G 5: 150,466,437 D2545G probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,569,499 probably benign Het
Kif5a T C 10: 127,246,009 probably benign Het
Lifr A G 15: 7,185,715 T768A probably benign Het
Mrap2 T C 9: 87,182,782 L192P possibly damaging Het
Myo18a G A 11: 77,840,709 R840Q possibly damaging Het
Myrfl T C 10: 116,817,788 D458G probably damaging Het
Olfr533 T C 7: 140,467,049 S283P possibly damaging Het
Olfr571 A G 7: 102,909,636 Y68H probably benign Het
Pcdh15 A G 10: 74,631,053 E1034G probably benign Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plcb2 G A 2: 118,712,483 probably benign Het
Psmd1 T C 1: 86,077,450 V202A possibly damaging Het
Raet1d T C 10: 22,370,896 I41T probably damaging Het
Retnlb T A 16: 48,817,226 L5Q possibly damaging Het
Sh3rf1 T C 8: 61,329,258 Y145H probably damaging Het
Smad7 C T 18: 75,393,862 H260Y probably benign Het
Stk10 T C 11: 32,598,653 V407A probably benign Het
Synpo A G 18: 60,603,503 V218A probably damaging Het
Tll2 T A 19: 41,103,850 Y499F probably damaging Het
Zfp748 A C 13: 67,545,362 L64W probably benign Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0332:Vrk1 UTSW 12 106058625 missense probably benign 0.05
R1897:Vrk1 UTSW 12 106036540 splice site probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106051793 missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106057972 missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106051828 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
R8154:Vrk1 UTSW 12 106070534 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTTGCTTATGCGGGCACCAGAC -3'
(R):5'- TGGGACGAGCTACAAAGAAATCCAC -3'

Sequencing Primer
(F):5'- GGGCACCAGACTACATTTCTC -3'
(R):5'- AGAGGCAGCTCTGGTTTCTAC -3'
Posted On2013-10-16