Mutagenetix > Incidental Mutation

Incidental Mutation 'R0796:Srp68'

76468

Institutional Source

Beutler Lab

Gene Symbol

Srp68

Ensembl Gene

ENSMUSG00000020780

Gene Name

signal recognition particle 68

Synonyms

2610024I03Rik

MMRRC Submission

038976-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R0796 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116135992-116165043 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 116137509 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 520 (R520Q)

Ref Sequence

ENSEMBL: ENSMUSP00000021133 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021133] [ENSMUST00000106425]

AlphaFold

Q8BMA6

Predicted Effect

probably benign
Transcript: ENSMUST00000021133
AA Change: R520Q

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000021133
Gene: ENSMUSG00000020780
AA Change: R520Q

Domain	Start	End	E-Value	Type
low complexity region	9	34	N/A	INTRINSIC
Pfam:SRP68	74	596	5.5e-156	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106425
AA Change: R482Q

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000102033
Gene: ENSMUSG00000020780
AA Change: R482Q

Domain	Start	End	E-Value	Type
low complexity region	9	34	N/A	INTRINSIC
PDB:4P3F\|B	46	215	1e-112	PDB
Blast:TPR	149	182	5e-15	BLAST
Blast:TPR	424	457	1e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128808

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.0%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]

Allele List at MGI

Other mutations in this stock

Total: 2 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
P3h3	G	T	6: 124,831,896 (GRCm39)	D296E	probably benign	Het
Txndc11	CCCGCCGCCGCCGCCGC	CCCGCCGCCGCCGC	16: 10,952,338 (GRCm39)		probably benign	Het

Other mutations in Srp68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01654:Srp68	APN	11	116,138,638 (GRCm39)	splice site	probably benign
IGL02974:Srp68	APN	11	116,137,051 (GRCm39)	missense	probably benign	0.31
tipsy	UTSW	11	116,136,638 (GRCm39)	missense	probably damaging	1.00
P0028:Srp68	UTSW	11	116,151,746 (GRCm39)	missense	probably damaging	0.99
R0211:Srp68	UTSW	11	116,156,377 (GRCm39)	missense	probably damaging	1.00
R0211:Srp68	UTSW	11	116,156,377 (GRCm39)	missense	probably damaging	1.00
R0468:Srp68	UTSW	11	116,139,590 (GRCm39)	missense	probably damaging	0.98
R1291:Srp68	UTSW	11	116,154,107 (GRCm39)	missense	probably damaging	1.00
R1906:Srp68	UTSW	11	116,141,587 (GRCm39)	missense	probably damaging	1.00
R2149:Srp68	UTSW	11	116,151,693 (GRCm39)	missense	possibly damaging	0.93
R3732:Srp68	UTSW	11	116,164,782 (GRCm39)	nonsense	probably null
R4651:Srp68	UTSW	11	116,164,840 (GRCm39)	missense	probably benign
R4652:Srp68	UTSW	11	116,164,840 (GRCm39)	missense	probably benign
R4686:Srp68	UTSW	11	116,156,227 (GRCm39)	missense	probably damaging	0.98
R4924:Srp68	UTSW	11	116,151,684 (GRCm39)	missense	probably damaging	1.00
R5077:Srp68	UTSW	11	116,136,638 (GRCm39)	missense	probably damaging	1.00
R5095:Srp68	UTSW	11	116,139,573 (GRCm39)	missense	probably damaging	0.98
R5166:Srp68	UTSW	11	116,156,300 (GRCm39)	missense	probably damaging	0.99
R5167:Srp68	UTSW	11	116,156,300 (GRCm39)	missense	probably damaging	0.99
R5168:Srp68	UTSW	11	116,156,300 (GRCm39)	missense	probably damaging	0.99
R5769:Srp68	UTSW	11	116,137,495 (GRCm39)	missense	probably damaging	1.00
R6379:Srp68	UTSW	11	116,156,227 (GRCm39)	missense	probably damaging	1.00
R6577:Srp68	UTSW	11	116,156,290 (GRCm39)	missense	probably damaging	1.00
R6777:Srp68	UTSW	11	116,153,730 (GRCm39)	missense	probably damaging	1.00
R7089:Srp68	UTSW	11	116,162,733 (GRCm39)	splice site	probably null
R7561:Srp68	UTSW	11	116,139,593 (GRCm39)	missense	probably damaging	0.99
R7823:Srp68	UTSW	11	116,156,265 (GRCm39)	missense	probably damaging	1.00
R7854:Srp68	UTSW	11	116,144,909 (GRCm39)	splice site	probably null
R8206:Srp68	UTSW	11	116,164,809 (GRCm39)	missense	probably damaging	0.98
R8407:Srp68	UTSW	11	116,143,589 (GRCm39)	missense	probably benign	0.00
Z1088:Srp68	UTSW	11	116,164,861 (GRCm39)	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGTTTTCCAAATTTTCCCGCACAG -3'
(R):5'- GAGCTATGTCAGCCTTTCCCACTTG -3'

Sequencing Primer
(F):5'- GCACAGTTCAGTGCCTAGTTTAAC -3'
(R):5'- tgttctctttgcctctacctc -3'

Posted On

2013-10-16