Incidental Mutation 'R0796:Txndc11'
ID76469
Institutional Source Beutler Lab
Gene Symbol Txndc11
Ensembl Gene ENSMUSG00000022498
Gene Namethioredoxin domain containing 11
Synonyms2810408E11Rik, EF-hand binding protein 1, Txdc11, EFP1
MMRRC Submission 038976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0796 (G1)
Quality Score103
Status Not validated
Chromosome16
Chromosomal Location11074911-11134650 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCCGCCGCCGCCGCCGC to CCCGCCGCCGCCGC at 11134474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000038424] [ENSMUST00000118362] [ENSMUST00000118679] [ENSMUST00000145225] [ENSMUST00000147884] [ENSMUST00000155221]
Predicted Effect probably benign
Transcript: ENSMUST00000037633
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038424
SMART Domains Protein: ENSMUSP00000041113
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.8e-11 PFAM
Pfam:Thioredoxin 660 756 1e-11 PFAM
coiled coil region 793 830 N/A INTRINSIC
low complexity region 927 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118362
SMART Domains Protein: ENSMUSP00000113432
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 2.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118679
SMART Domains Protein: ENSMUSP00000112601
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 4.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143121
Predicted Effect probably benign
Transcript: ENSMUST00000145225
SMART Domains Protein: ENSMUSP00000116563
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
Pfam:Thioredoxin 107 208 5.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147884
SMART Domains Protein: ENSMUSP00000117426
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155221
SMART Domains Protein: ENSMUSP00000114777
Gene: ENSMUSG00000022498

DomainStartEndE-ValueType
low complexity region 2 42 N/A INTRINSIC
low complexity region 61 76 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.0%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
P3h3 G T 6: 124,854,933 D296E probably benign Het
Srp68 C T 11: 116,246,683 R520Q probably benign Het
Other mutations in Txndc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL00563:Txndc11 APN 16 11104632 missense probably damaging 0.96
IGL02576:Txndc11 APN 16 11075017 unclassified probably benign
IGL03070:Txndc11 APN 16 11075287 missense probably damaging 0.97
P0047:Txndc11 UTSW 16 11091797 splice site probably benign
R0091:Txndc11 UTSW 16 11088104 missense probably benign
R0448:Txndc11 UTSW 16 11091761 missense probably damaging 0.99
R0960:Txndc11 UTSW 16 11091589 missense probably benign 0.28
R1184:Txndc11 UTSW 16 11128500 missense probably benign 0.03
R1327:Txndc11 UTSW 16 11116814 missense possibly damaging 0.86
R1441:Txndc11 UTSW 16 11134550 start gained probably benign
R1515:Txndc11 UTSW 16 11075062 missense probably damaging 0.98
R1699:Txndc11 UTSW 16 11087775 critical splice donor site probably null
R1709:Txndc11 UTSW 16 11128701 nonsense probably null
R1850:Txndc11 UTSW 16 11088404 missense probably damaging 0.98
R2026:Txndc11 UTSW 16 11134474 small deletion probably benign
R3433:Txndc11 UTSW 16 11088188 missense probably benign
R4468:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4469:Txndc11 UTSW 16 11075223 missense probably benign 0.01
R4652:Txndc11 UTSW 16 11075122 missense probably benign
R4675:Txndc11 UTSW 16 11084881 missense possibly damaging 0.65
R4697:Txndc11 UTSW 16 11084314 missense probably damaging 0.99
R4907:Txndc11 UTSW 16 11088534 missense probably benign 0.17
R5205:Txndc11 UTSW 16 11128665 missense probably damaging 0.98
R5273:Txndc11 UTSW 16 11128623 missense probably benign 0.07
R5865:Txndc11 UTSW 16 11122688 missense probably damaging 1.00
R5873:Txndc11 UTSW 16 11075205 missense probably damaging 1.00
R5941:Txndc11 UTSW 16 11075071 missense probably benign 0.04
R6360:Txndc11 UTSW 16 11084792 missense probably damaging 1.00
R6894:Txndc11 UTSW 16 11088145 missense probably damaging 1.00
R7285:Txndc11 UTSW 16 11084299 missense probably damaging 0.98
R7334:Txndc11 UTSW 16 11128561 missense probably damaging 1.00
R7502:Txndc11 UTSW 16 11087878 missense probably benign 0.08
R7660:Txndc11 UTSW 16 11087929 missense probably damaging 1.00
R7677:Txndc11 UTSW 16 11134474 small deletion probably benign
R7683:Txndc11 UTSW 16 11084235 missense probably damaging 1.00
R8315:Txndc11 UTSW 16 11075601 missense possibly damaging 0.70
X0020:Txndc11 UTSW 16 11084218 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACCTGCAAGTGAACTTGAGGGC -3'
(R):5'- ACGCACTAGCGACAATCTGAGC -3'

Sequencing Primer
(F):5'- TGAACTTGAGGGCGAAGAGC -3'
(R):5'- TAGCTTGAGTGACTGCAAGCC -3'
Posted On2013-10-16