Incidental Mutation 'R0798:C130074G19Rik'
ID76477
Institutional Source Beutler Lab
Gene Symbol C130074G19Rik
Ensembl Gene ENSMUSG00000039349
Gene NameRIKEN cDNA C130074G19 gene
Synonyms
MMRRC Submission 038978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0798 (G1)
Quality Score88
Status Validated
Chromosome1
Chromosomal Location184871926-184883218 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 184882676 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048308]
Predicted Effect probably benign
Transcript: ENSMUST00000048308
SMART Domains Protein: ENSMUSP00000041904
Gene: ENSMUSG00000039349

DomainStartEndE-ValueType
Pfam:DUF4710 62 134 1.6e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4930579C12Rik T A 9: 89,152,827 noncoding transcript Het
Baz2a T A 10: 128,126,323 probably benign Het
Bcar3 T C 3: 122,525,299 V695A probably benign Het
Cmas T C 6: 142,764,656 V167A probably damaging Het
Cyp3a25 T C 5: 145,991,533 E234G probably damaging Het
Fam208a T A 14: 27,476,636 F1308L probably damaging Het
Gopc C T 10: 52,358,811 G79S probably damaging Het
Herc2 T A 7: 56,135,683 probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ispd G A 12: 36,521,999 R302H probably benign Het
Kcnq5 A G 1: 21,961,175 probably null Het
Lpp G T 16: 24,971,872 G29* probably null Het
Ly6g6e T C 17: 35,078,041 F86S probably benign Het
Myo5c T C 9: 75,257,984 F358S probably damaging Het
Nlgn1 A G 3: 25,434,246 Y613H probably benign Het
Olfr1282 T C 2: 111,335,344 I245V probably benign Het
Olfr18 A T 9: 20,314,199 Y232* probably null Het
Plekhn1 T A 4: 156,228,263 D46V probably damaging Het
Ptp4a1 A T 1: 30,944,924 probably benign Het
Rab23 A T 1: 33,734,827 I123F probably damaging Het
Samd4b G A 7: 28,401,623 probably benign Het
Shisa4 G A 1: 135,373,148 probably benign Het
Slc39a11 C T 11: 113,523,504 A90T probably benign Het
Tas1r2 T C 4: 139,669,713 Y788H probably damaging Het
Tial1 C T 7: 128,443,878 M327I probably benign Het
Ubr2 C T 17: 46,969,176 probably benign Het
Utp4 T C 8: 106,922,226 S630P probably benign Het
Vmn1r212 T C 13: 22,883,698 N155S probably damaging Het
Zmym6 C T 4: 127,103,523 P312S probably benign Het
Other mutations in C130074G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:C130074G19Rik APN 1 184882746 missense probably damaging 0.99
IGL03193:C130074G19Rik APN 1 184882702 missense probably damaging 1.00
R0008:C130074G19Rik UTSW 1 184882922 missense probably benign 0.02
R1512:C130074G19Rik UTSW 1 184882906 missense probably damaging 1.00
R1957:C130074G19Rik UTSW 1 184882898 missense probably benign
R2351:C130074G19Rik UTSW 1 184882863 missense probably benign 0.03
R7246:C130074G19Rik UTSW 1 184882969 missense probably damaging 0.99
R7478:C130074G19Rik UTSW 1 184874427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCAGCATTACCATCAGCTCC -3'
(R):5'- TGCCTACCCTGAGCAATGGTTTC -3'

Sequencing Primer
(F):5'- CTCCAACTGGGAGCAAGG -3'
(R):5'- AAAGGTTGCCTCATAGCCTG -3'
Posted On2013-10-16