Incidental Mutation 'R0798:Cmas'
ID76485
Institutional Source Beutler Lab
Gene Symbol Cmas
Ensembl Gene ENSMUSG00000030282
Gene Namecytidine monophospho-N-acetylneuraminic acid synthetase
SynonymsCMP-Neu5Ac synthase, CMP-sialic acid synthetase, D6Bwg0250e
MMRRC Submission 038978-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R0798 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142756686-142775714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142764656 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000032419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032419] [ENSMUST00000133248] [ENSMUST00000144920]
Predicted Effect probably damaging
Transcript: ENSMUST00000032419
AA Change: V167A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032419
Gene: ENSMUSG00000030282
AA Change: V167A

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 301 3.8e-69 PFAM
Pfam:NTP_transf_3 45 228 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133248
SMART Domains Protein: ENSMUSP00000144875
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144920
SMART Domains Protein: ENSMUSP00000145392
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204147
Meta Mutation Damage Score 0.4937 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that converts N-acetylneuraminic acid (NeuNAc) to cytidine 5'-monophosphate N-acetylneuraminic acid (CMP-NeuNAc). This process is important in the formation of sialylated glycoprotein and glycolipids. This modification plays a role in cell-cell communications and immune responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4930579C12Rik T A 9: 89,152,827 noncoding transcript Het
Baz2a T A 10: 128,126,323 probably benign Het
Bcar3 T C 3: 122,525,299 V695A probably benign Het
C130074G19Rik G A 1: 184,882,676 probably benign Het
Cyp3a25 T C 5: 145,991,533 E234G probably damaging Het
Fam208a T A 14: 27,476,636 F1308L probably damaging Het
Gopc C T 10: 52,358,811 G79S probably damaging Het
Herc2 T A 7: 56,135,683 probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ispd G A 12: 36,521,999 R302H probably benign Het
Kcnq5 A G 1: 21,961,175 probably null Het
Lpp G T 16: 24,971,872 G29* probably null Het
Ly6g6e T C 17: 35,078,041 F86S probably benign Het
Myo5c T C 9: 75,257,984 F358S probably damaging Het
Nlgn1 A G 3: 25,434,246 Y613H probably benign Het
Olfr1282 T C 2: 111,335,344 I245V probably benign Het
Olfr18 A T 9: 20,314,199 Y232* probably null Het
Plekhn1 T A 4: 156,228,263 D46V probably damaging Het
Ptp4a1 A T 1: 30,944,924 probably benign Het
Rab23 A T 1: 33,734,827 I123F probably damaging Het
Samd4b G A 7: 28,401,623 probably benign Het
Shisa4 G A 1: 135,373,148 probably benign Het
Slc39a11 C T 11: 113,523,504 A90T probably benign Het
Tas1r2 T C 4: 139,669,713 Y788H probably damaging Het
Tial1 C T 7: 128,443,878 M327I probably benign Het
Ubr2 C T 17: 46,969,176 probably benign Het
Utp4 T C 8: 106,922,226 S630P probably benign Het
Vmn1r212 T C 13: 22,883,698 N155S probably damaging Het
Zmym6 C T 4: 127,103,523 P312S probably benign Het
Other mutations in Cmas
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Cmas UTSW 6 142775244 nonsense probably null
R1172:Cmas UTSW 6 142756878 missense probably benign 0.01
R1453:Cmas UTSW 6 142772127 missense probably damaging 1.00
R1983:Cmas UTSW 6 142770586 missense probably damaging 0.98
R2147:Cmas UTSW 6 142771289 missense probably benign 0.18
R3795:Cmas UTSW 6 142767868 missense probably benign 0.03
R4378:Cmas UTSW 6 142772285 unclassified probably benign
R4768:Cmas UTSW 6 142764431 critical splice donor site probably null
R6430:Cmas UTSW 6 142767924 missense probably benign
R6774:Cmas UTSW 6 142764421 missense possibly damaging 0.81
R6824:Cmas UTSW 6 142771236 missense possibly damaging 0.90
R6980:Cmas UTSW 6 142756800 missense probably damaging 0.97
R7256:Cmas UTSW 6 142770586 missense probably damaging 1.00
R7776:Cmas UTSW 6 142764557 missense probably damaging 0.99
R7969:Cmas UTSW 6 142775166 missense probably damaging 1.00
R8325:Cmas UTSW 6 142771339 critical splice donor site probably null
R8363:Cmas UTSW 6 142756828 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGCTCTACCTCACTAGACGCCATTG -3'
(R):5'- GGAATATCCTGTCACTGCCTACTGC -3'

Sequencing Primer
(F):5'- GACGCCATTGTAGAATTCCTG -3'
(R):5'- TACCCCAAGCACTGTCAGT -3'
Posted On2013-10-16