Incidental Mutation 'R0798:Lpp'
ID76500
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene NameLIM domain containing preferred translocation partner in lipoma
SynonymsB130055L10Rik, 9430020K16Rik
MMRRC Submission 038978-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R0798 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location24393507-24992578 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 24971872 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 29 (G29*)
Ref Sequence ENSEMBL: ENSMUSP00000156178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314] [ENSMUST00000232546]
Predicted Effect probably damaging
Transcript: ENSMUST00000038053
AA Change: M485I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: M485I

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078988
AA Change: M485I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: M485I

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115314
AA Change: M360I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306
AA Change: M360I

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
LIM 291 344 1.03e-16 SMART
LIM 351 403 1.94e-12 SMART
LIM 411 472 2.5e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232546
AA Change: G29*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4930579C12Rik T A 9: 89,152,827 noncoding transcript Het
Baz2a T A 10: 128,126,323 probably benign Het
Bcar3 T C 3: 122,525,299 V695A probably benign Het
C130074G19Rik G A 1: 184,882,676 probably benign Het
Cmas T C 6: 142,764,656 V167A probably damaging Het
Cyp3a25 T C 5: 145,991,533 E234G probably damaging Het
Fam208a T A 14: 27,476,636 F1308L probably damaging Het
Gopc C T 10: 52,358,811 G79S probably damaging Het
Herc2 T A 7: 56,135,683 probably null Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ispd G A 12: 36,521,999 R302H probably benign Het
Kcnq5 A G 1: 21,961,175 probably null Het
Ly6g6e T C 17: 35,078,041 F86S probably benign Het
Myo5c T C 9: 75,257,984 F358S probably damaging Het
Nlgn1 A G 3: 25,434,246 Y613H probably benign Het
Olfr1282 T C 2: 111,335,344 I245V probably benign Het
Olfr18 A T 9: 20,314,199 Y232* probably null Het
Plekhn1 T A 4: 156,228,263 D46V probably damaging Het
Ptp4a1 A T 1: 30,944,924 probably benign Het
Rab23 A T 1: 33,734,827 I123F probably damaging Het
Samd4b G A 7: 28,401,623 probably benign Het
Shisa4 G A 1: 135,373,148 probably benign Het
Slc39a11 C T 11: 113,523,504 A90T probably benign Het
Tas1r2 T C 4: 139,669,713 Y788H probably damaging Het
Tial1 C T 7: 128,443,878 M327I probably benign Het
Ubr2 C T 17: 46,969,176 probably benign Het
Utp4 T C 8: 106,922,226 S630P probably benign Het
Vmn1r212 T C 13: 22,883,698 N155S probably damaging Het
Zmym6 C T 4: 127,103,523 P312S probably benign Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24845188 missense probably damaging 1.00
IGL01354:Lpp APN 16 24762066 nonsense probably null
IGL02141:Lpp APN 16 24761615 missense probably damaging 0.98
IGL02182:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02230:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02232:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02234:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02236:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02371:Lpp APN 16 24761611 missense probably damaging 0.96
IGL03265:Lpp APN 16 24761987 missense probably damaging 1.00
PIT4585001:Lpp UTSW 16 24761947 missense probably benign 0.23
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0092:Lpp UTSW 16 24761602 missense probably benign 0.01
R0385:Lpp UTSW 16 24761837 missense probably damaging 1.00
R0389:Lpp UTSW 16 24608241 missense probably damaging 1.00
R0504:Lpp UTSW 16 24971970 missense probably damaging 1.00
R1199:Lpp UTSW 16 24681860 missense probably damaging 1.00
R1581:Lpp UTSW 16 24681841 nonsense probably null
R1755:Lpp UTSW 16 24845124 missense probably benign
R1848:Lpp UTSW 16 24761655 missense probably damaging 1.00
R1980:Lpp UTSW 16 24661701 missense probably damaging 1.00
R3432:Lpp UTSW 16 24889886 missense probably benign 0.04
R3755:Lpp UTSW 16 24845161 missense probably benign 0.00
R4078:Lpp UTSW 16 24681861 missense probably damaging 1.00
R4214:Lpp UTSW 16 24762054 nonsense probably null
R4712:Lpp UTSW 16 24761657 missense possibly damaging 0.94
R4806:Lpp UTSW 16 24661680 missense probably damaging 0.97
R4968:Lpp UTSW 16 24979314 missense probably damaging 1.00
R5047:Lpp UTSW 16 24971846 missense probably damaging 1.00
R5371:Lpp UTSW 16 24889804 missense probably damaging 1.00
R5536:Lpp UTSW 16 24845206 missense possibly damaging 0.54
R5875:Lpp UTSW 16 24608309 missense probably benign 0.10
R7285:Lpp UTSW 16 24977279 missense probably damaging 1.00
R7587:Lpp UTSW 16 24762279 splice site probably null
R7846:Lpp UTSW 16 24608126 start codon destroyed probably null 0.98
Z1176:Lpp UTSW 16 24761603 missense probably benign 0.00
Z1177:Lpp UTSW 16 24661712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTTTGATGTCGCCGATGCTGC -3'
(R):5'- TGCGCCAGAGATCACTCTTGGAAC -3'

Sequencing Primer
(F):5'- CCGATGCTGCTGCAAAC -3'
(R):5'- GAGATCACTCTTGGAACATCTCC -3'
Posted On2013-10-16