Incidental Mutation 'R0799:Iqca'
ID 76504
Institutional Source Beutler Lab
Gene Symbol Iqca
Ensembl Gene ENSMUSG00000026301
Gene Name IQ motif containing with AAA domain
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0799 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 90042132-90153401 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 90142731 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 133 (G133V)
Ref Sequence ENSEMBL: ENSMUSP00000108717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113094] [ENSMUST00000113094] [ENSMUST00000212394] [ENSMUST00000212394]
AlphaFold Q9CUL5
Predicted Effect probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113094
AA Change: G133V

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108717
Gene: ENSMUSG00000026301
AA Change: G133V

IQ 205 227 6.97e0 SMART
coiled coil region 340 380 N/A INTRINSIC
coiled coil region 425 450 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
AAA 567 706 1.08e-3 SMART
low complexity region 812 829 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211999
Predicted Effect probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably null
Transcript: ENSMUST00000212394
AA Change: G133V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1927 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Iqca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Iqca APN 1 90045657 missense probably benign 0.10
IGL01367:Iqca APN 1 90070628 splice site probably benign
IGL01545:Iqca APN 1 90045642 missense probably benign
IGL01797:Iqca APN 1 90144819 critical splice donor site probably null
IGL02098:Iqca APN 1 90047941 missense probably damaging 0.96
IGL02194:Iqca APN 1 90045663 missense probably benign 0.16
IGL03230:Iqca APN 1 90145002 missense probably damaging 1.00
IGL03259:Iqca APN 1 90052434 missense probably damaging 1.00
IGL03372:Iqca APN 1 90144969 missense possibly damaging 0.80
R0383:Iqca UTSW 1 90142707 missense probably damaging 1.00
R0610:Iqca UTSW 1 90142731 missense probably null 0.97
R0685:Iqca UTSW 1 90142731 missense probably null 0.97
R0798:Iqca UTSW 1 90142731 missense probably null 0.97
R0800:Iqca UTSW 1 90142731 missense probably null 0.97
R0801:Iqca UTSW 1 90142731 missense probably null 0.97
R0825:Iqca UTSW 1 90142731 missense probably null 0.97
R0826:Iqca UTSW 1 90142731 missense probably null 0.97
R0827:Iqca UTSW 1 90142731 missense probably null 0.97
R0862:Iqca UTSW 1 90142731 missense probably null 0.97
R0863:Iqca UTSW 1 90142731 missense probably null 0.97
R0864:Iqca UTSW 1 90142731 missense probably null 0.97
R0960:Iqca UTSW 1 90142731 missense probably null 0.97
R0961:Iqca UTSW 1 90142731 missense probably null 0.97
R0962:Iqca UTSW 1 90142731 missense probably null 0.97
R0963:Iqca UTSW 1 90142731 missense probably null 0.97
R1101:Iqca UTSW 1 90142731 missense probably null 0.97
R1344:Iqca UTSW 1 90142731 missense probably null 0.97
R1523:Iqca UTSW 1 90142731 missense probably null 0.97
R1646:Iqca UTSW 1 90140038 missense probably damaging 0.98
R1682:Iqca UTSW 1 90142731 missense probably null 0.97
R1742:Iqca UTSW 1 90098051 missense probably benign 0.01
R1774:Iqca UTSW 1 90080903 missense probably benign 0.02
R1775:Iqca UTSW 1 90081416 missense probably damaging 1.00
R2011:Iqca UTSW 1 90045626 missense probably benign 0.00
R2065:Iqca UTSW 1 90130231 missense probably benign 0.01
R2156:Iqca UTSW 1 90089516 missense possibly damaging 0.78
R2186:Iqca UTSW 1 90081344 missense probably benign 0.06
R3872:Iqca UTSW 1 90089481 missense probably damaging 1.00
R4308:Iqca UTSW 1 90144897 missense probably damaging 1.00
R4578:Iqca UTSW 1 90073750 missense probably damaging 0.98
R4737:Iqca UTSW 1 90077822 missense probably damaging 0.99
R4867:Iqca UTSW 1 90089504 missense probably benign 0.00
R4884:Iqca UTSW 1 90140037 missense probably benign 0.10
R4887:Iqca UTSW 1 90045701 missense probably damaging 1.00
R5352:Iqca UTSW 1 90130196 missense probably benign 0.00
R5733:Iqca UTSW 1 90070535 missense probably damaging 0.97
R5838:Iqca UTSW 1 90144945 missense probably benign 0.22
R5951:Iqca UTSW 1 90140097 splice site probably null
R5957:Iqca UTSW 1 90080948 missense probably damaging 1.00
R6696:Iqca UTSW 1 90130200 missense probably benign
R7240:Iqca UTSW 1 90070550 missense possibly damaging 0.88
R7769:Iqca UTSW 1 90077810 missense possibly damaging 0.82
R7841:Iqca UTSW 1 90059615 missense
R8069:Iqca UTSW 1 90045744 missense probably damaging 0.96
R8103:Iqca UTSW 1 90059608 missense
R8932:Iqca UTSW 1 90140028 missense probably damaging 1.00
R8963:Iqca UTSW 1 90139927 missense probably benign 0.02
R9055:Iqca UTSW 1 90070613 missense probably benign 0.02
R9168:Iqca UTSW 1 90138215 missense probably damaging 0.98
R9342:Iqca UTSW 1 90144966 missense probably damaging 0.99
Z1176:Iqca UTSW 1 90045725 missense probably benign 0.26
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccacaaacacccttacccac -3'
Posted On 2013-10-16