Incidental Mutation 'R0799:Chd5'
ID76519
Institutional Source Beutler Lab
Gene Symbol Chd5
Ensembl Gene ENSMUSG00000005045
Gene Namechromodomain helicase DNA binding protein 5
Synonyms
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152338651-152390194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152384159 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1760 (D1760G)
Ref Sequence ENSEMBL: ENSMUSP00000005175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]
Predicted Effect probably damaging
Transcript: ENSMUST00000005175
AA Change: D1760G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: D1760G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 2e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1729 1901 1.7e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030775
AA Change: D1760G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: D1760G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 150 203 9e-28 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1297 1361 2.78e-33 SMART
DUF1086 1374 1533 5.11e-105 SMART
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1685 1701 N/A INTRINSIC
Pfam:CHDCT2 1730 1901 2.8e-93 PFAM
low complexity region 1922 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124423
Predicted Effect possibly damaging
Transcript: ENSMUST00000164662
AA Change: D1723G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: D1723G

DomainStartEndE-ValueType
low complexity region 17 40 N/A INTRINSIC
low complexity region 46 71 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
Pfam:CHDNT 149 203 1.9e-32 PFAM
low complexity region 209 220 N/A INTRINSIC
low complexity region 256 273 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
PHD 347 390 1.09e-14 SMART
RING 348 389 4.48e-1 SMART
low complexity region 400 416 N/A INTRINSIC
PHD 420 463 3.29e-14 SMART
RING 421 462 4.15e0 SMART
CHROMO 468 548 2.52e-13 SMART
CHROMO 592 649 1.34e-8 SMART
low complexity region 657 678 N/A INTRINSIC
DEXDc 698 910 8.34e-33 SMART
low complexity region 1023 1038 N/A INTRINSIC
HELICc 1056 1140 4.02e-26 SMART
DUF1087 1260 1324 2.78e-33 SMART
DUF1086 1337 1496 5.11e-105 SMART
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1648 1664 N/A INTRINSIC
Pfam:CHDCT2 1692 1864 1.7e-99 PFAM
low complexity region 1885 1899 N/A INTRINSIC
Meta Mutation Damage Score 0.8039 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Chd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Chd5 APN 4 152360602 missense probably damaging 1.00
IGL00886:Chd5 APN 4 152359699 missense probably benign 0.00
IGL00963:Chd5 APN 4 152382938 missense probably damaging 1.00
IGL01399:Chd5 APN 4 152356687 missense probably damaging 1.00
IGL01571:Chd5 APN 4 152384115 splice site probably benign
IGL01606:Chd5 APN 4 152360975 missense probably damaging 0.99
IGL01636:Chd5 APN 4 152384653 nonsense probably null
IGL02009:Chd5 APN 4 152366213 missense probably damaging 1.00
IGL02417:Chd5 APN 4 152367294 missense probably damaging 0.97
IGL02504:Chd5 APN 4 152363322 missense probably damaging 0.99
IGL02508:Chd5 APN 4 152363024 missense probably damaging 1.00
IGL02597:Chd5 APN 4 152371712 missense probably damaging 1.00
IGL02608:Chd5 APN 4 152356107 missense possibly damaging 0.94
IGL02612:Chd5 APN 4 152360576 missense probably damaging 1.00
IGL02658:Chd5 APN 4 152360593 missense probably damaging 1.00
IGL02662:Chd5 APN 4 152372131 missense probably damaging 1.00
IGL02676:Chd5 APN 4 152356073 splice site probably benign
IGL02871:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL02942:Chd5 APN 4 152385725 missense probably damaging 0.98
IGL02956:Chd5 APN 4 152379956 missense probably benign 0.00
IGL03286:Chd5 APN 4 152385495 missense probably benign 0.00
IGL03348:Chd5 APN 4 152376685 missense probably damaging 1.00
IGL03398:Chd5 APN 4 152377082 missense probably damaging 0.97
PIT1430001:Chd5 UTSW 4 152370637 missense probably damaging 1.00
PIT4151001:Chd5 UTSW 4 152378529 missense probably damaging 0.99
R0079:Chd5 UTSW 4 152385749 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0241:Chd5 UTSW 4 152366132 missense probably damaging 1.00
R0379:Chd5 UTSW 4 152383321 missense probably benign 0.00
R0388:Chd5 UTSW 4 152371644 missense probably damaging 1.00
R0675:Chd5 UTSW 4 152385950 missense probably benign 0.06
R0730:Chd5 UTSW 4 152347984 missense possibly damaging 0.72
R0800:Chd5 UTSW 4 152356157 missense probably damaging 1.00
R1276:Chd5 UTSW 4 152378734 missense probably damaging 1.00
R1752:Chd5 UTSW 4 152375133 missense probably damaging 1.00
R1753:Chd5 UTSW 4 152378815 missense probably damaging 1.00
R1843:Chd5 UTSW 4 152385806 missense probably damaging 1.00
R1850:Chd5 UTSW 4 152370533 missense probably damaging 1.00
R1851:Chd5 UTSW 4 152378270 missense probably damaging 0.97
R1859:Chd5 UTSW 4 152380523 missense probably benign 0.00
R1983:Chd5 UTSW 4 152384666 missense possibly damaging 0.89
R2404:Chd5 UTSW 4 152367334 missense probably damaging 1.00
R2897:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R2898:Chd5 UTSW 4 152372115 missense probably damaging 1.00
R3893:Chd5 UTSW 4 152360656 missense probably damaging 1.00
R3938:Chd5 UTSW 4 152377055 missense probably benign 0.05
R4707:Chd5 UTSW 4 152360582 missense probably damaging 1.00
R4754:Chd5 UTSW 4 152377746 missense probably damaging 0.99
R4911:Chd5 UTSW 4 152360672 missense probably damaging 1.00
R4924:Chd5 UTSW 4 152366429 missense possibly damaging 0.50
R4926:Chd5 UTSW 4 152383311 missense probably benign 0.00
R5256:Chd5 UTSW 4 152372097 missense probably benign 0.01
R5524:Chd5 UTSW 4 152376630 missense probably benign
R5552:Chd5 UTSW 4 152385815 missense possibly damaging 0.95
R5895:Chd5 UTSW 4 152379932 missense probably benign 0.13
R5945:Chd5 UTSW 4 152379951 missense probably benign
R6007:Chd5 UTSW 4 152379421 missense probably null 1.00
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6039:Chd5 UTSW 4 152353621 small deletion probably benign
R6172:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6173:Chd5 UTSW 4 152379391 missense probably damaging 1.00
R6323:Chd5 UTSW 4 152367334 missense probably damaging 0.99
R6331:Chd5 UTSW 4 152382408 missense probably benign 0.02
R6495:Chd5 UTSW 4 152367372 missense probably damaging 1.00
R6528:Chd5 UTSW 4 152356676 missense probably damaging 1.00
R6849:Chd5 UTSW 4 152378538 missense probably damaging 1.00
R6854:Chd5 UTSW 4 152382938 missense probably damaging 1.00
R6859:Chd5 UTSW 4 152378207 missense probably damaging 1.00
R6999:Chd5 UTSW 4 152374434 missense probably damaging 1.00
R7034:Chd5 UTSW 4 152360941 missense possibly damaging 0.89
R7110:Chd5 UTSW 4 152385439 missense probably damaging 1.00
R7361:Chd5 UTSW 4 152363288 missense probably damaging 0.99
R7397:Chd5 UTSW 4 152368012 missense possibly damaging 0.82
R7440:Chd5 UTSW 4 152384651 missense probably benign 0.01
R7489:Chd5 UTSW 4 152373468 missense probably damaging 1.00
R7810:Chd5 UTSW 4 152358575 missense probably damaging 0.97
R8057:Chd5 UTSW 4 152366372 missense probably damaging 1.00
R8078:Chd5 UTSW 4 152360991 missense possibly damaging 0.90
R8092:Chd5 UTSW 4 152378804 missense probably damaging 0.99
R8170:Chd5 UTSW 4 152376583 missense probably benign 0.26
R8255:Chd5 UTSW 4 152379423 missense probably damaging 0.99
Z1176:Chd5 UTSW 4 152378479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCACAGCCTGCTAATGTCACTG -3'
(R):5'- AGGAGTCTCTACACTGGAGCCTTG -3'

Sequencing Primer
(F):5'- cagatattgttacagatggttgtgag -3'
(R):5'- ACTGGAGCCTTGCCTGTG -3'
Posted On2013-10-16