Incidental Mutation 'R0799:Atad3a'
ID76520
Institutional Source Beutler Lab
Gene Symbol Atad3a
Ensembl Gene ENSMUSG00000029036
Gene NameATPase family, AAA domain containing 3A
SynonymsTob3, 2400004H09Rik
MMRRC Submission 038979-MU
Accession Numbers

Genbank: NM_179203; MGI:1919214

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155740641-155761093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155747470 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000030903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030903] [ENSMUST00000184913]
Predicted Effect probably damaging
Transcript: ENSMUST00000030903
AA Change: V449A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030903
Gene: ENSMUSG00000029036
AA Change: V449A

DomainStartEndE-ValueType
Pfam:DUF3523 26 285 9.5e-113 PFAM
AAA 343 482 4.43e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126725
Predicted Effect probably benign
Transcript: ENSMUST00000175679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177066
Predicted Effect probably benign
Transcript: ENSMUST00000184131
Predicted Effect probably benign
Transcript: ENSMUST00000184913
SMART Domains Protein: ENSMUSP00000138808
Gene: ENSMUSG00000029036

DomainStartEndE-ValueType
Pfam:DUF3523 1 125 9.9e-43 PFAM
Meta Mutation Damage Score 0.7272 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed mitochondrial membrane protein that contributes to mitochondrial dynamics, nucleoid organization, protein translation, cell growth, and cholesterol metabolism. This gene is a member of the ATPase family AAA-domain containing 3 gene family which, in humans, includes two other paralogs. Naturally occurring mutations in this gene are associated with distinct neurological syndromes including Harel-Yoon syndrome. High-level expression of this gene is associated with poor survival in breast cancer patients. A homozygous knockout of the orthologous gene in mice results in embryonic lethality at day 7.5 due to growth retardation and defective development of the trophoblast lineage. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a gene trapped allele die around E7.5 exhibiting growth retardation, failure to gastrulate, and impaired development of the trophoblast lineage immediately after implantation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Atad3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Atad3a APN 4 155746078 missense probably damaging 0.98
IGL01982:Atad3a APN 4 155753927 missense possibly damaging 0.94
IGL02059:Atad3a APN 4 155754750 splice site probably benign
IGL02572:Atad3a APN 4 155753584 missense possibly damaging 0.61
IGL03086:Atad3a APN 4 155748670 critical splice donor site probably null
IGL03409:Atad3a APN 4 155747350 missense probably damaging 0.99
E2594:Atad3a UTSW 4 155750933 unclassified probably benign
FR4976:Atad3a UTSW 4 155753939 missense probably damaging 0.98
PIT4618001:Atad3a UTSW 4 155750138 missense probably benign 0.41
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0233:Atad3a UTSW 4 155746067 missense probably damaging 0.99
R0601:Atad3a UTSW 4 155747407 missense probably damaging 1.00
R1428:Atad3a UTSW 4 155755682 missense probably damaging 1.00
R1597:Atad3a UTSW 4 155751435 critical splice donor site probably null
R2188:Atad3a UTSW 4 155751519 missense probably damaging 0.99
R4126:Atad3a UTSW 4 155754061 splice site probably benign
R4564:Atad3a UTSW 4 155747309 splice site probably null
R5334:Atad3a UTSW 4 155755689 missense probably damaging 1.00
R6354:Atad3a UTSW 4 155753945 missense possibly damaging 0.58
R6481:Atad3a UTSW 4 155753641 splice site probably null
R7220:Atad3a UTSW 4 155754041 missense probably benign 0.02
R7689:Atad3a UTSW 4 155756153 missense probably damaging 0.98
R8127:Atad3a UTSW 4 155753939 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCCTCCCGTAAAGAGCAGTGAG -3'
(R):5'- GGAGAGCTGCCAAGTTACATCCATC -3'

Sequencing Primer
(F):5'- TTGCCAGGGCACATGTACAG -3'
(R):5'- ACAGAGAAACCCTGTCTCGA -3'
Posted On2013-10-16