Incidental Mutation 'R0799:Crybb2'
ID76522
Institutional Source Beutler Lab
Gene Symbol Crybb2
Ensembl Gene ENSMUSG00000042240
Gene Namecrystallin, beta B2
SynonymsbetaB2-crystallin, Aey2, Cryb-2
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location113058258-113070117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113062171 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 109 (I109V)
Ref Sequence ENSEMBL: ENSMUSP00000107955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031295] [ENSMUST00000112336]
Predicted Effect probably benign
Transcript: ENSMUST00000031295
AA Change: I109V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031295
Gene: ENSMUSG00000042240
AA Change: I109V

DomainStartEndE-ValueType
XTALbg 18 100 2.56e-39 SMART
XTALbg 108 190 7.08e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112336
AA Change: I109V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107955
Gene: ENSMUSG00000042240
AA Change: I109V

DomainStartEndE-ValueType
XTALbg 18 100 2.56e-39 SMART
XTALbg 108 190 7.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199639
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene is a member of the beta-crystallin family. Beta crystallins, along with alpha and gamma crystallins, are the major proteins found in the eye lens. These proteins maintain the refractive index of the lens whilst also maintaining its transparency. Since lens central fiber cells lose their nuclei during development, crystallins are made and then retained throughout life, making them extremely stable proteins. Beta and gamma crystallins are considered be a superfamily and have a similar domain architecture, including four Greek Key motifs. Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. The protein encoded by this gene may have Ca2+-binding activity and could be associated with potential functions in the hippocampus and in sperm. Targeted knockout of this gene in mouse induces age-related cataract. A chain-terminating mutation in a similar gene in human was found to cause type 2 cerulean cataracts. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mutations in this gene cause progressive lens cataracts discernable at 12-15 days of age as mild anterior or cortical opacity and progressing to total opacity by 6-12 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Crybb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02210:Crybb2 APN 5 113058387 missense probably damaging 1.00
IGL02405:Crybb2 APN 5 113058508 missense probably damaging 1.00
R4853:Crybb2 UTSW 5 113063188 missense probably damaging 0.99
R5873:Crybb2 UTSW 5 113065893 critical splice donor site probably null
R7567:Crybb2 UTSW 5 113065893 critical splice donor site probably null
Z1177:Crybb2 UTSW 5 113058435 missense probably damaging 0.99
Z1177:Crybb2 UTSW 5 113058436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTACAGCCTAGTGATTCCC -3'
(R):5'- GTTGCTCCTTAGGCATCCAGTCAG -3'

Sequencing Primer
(F):5'- AGTGATTCCCATCAGATGGTC -3'
(R):5'- TAGGCATCCAGTCAGGGGAC -3'
Posted On2013-10-16