Incidental Mutation 'R0799:Arntl2'
ID76526
Institutional Source Beutler Lab
Gene Symbol Arntl2
Ensembl Gene ENSMUSG00000040187
Gene Namearyl hydrocarbon receptor nuclear translocator-like 2
SynonymsMOP9, 4632430A05Rik, bHLHe6, BMAL2
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146796055-146833529 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 146823253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080530] [ENSMUST00000111636] [ENSMUST00000111638] [ENSMUST00000111639] [ENSMUST00000129788]
Predicted Effect probably benign
Transcript: ENSMUST00000080530
SMART Domains Protein: ENSMUSP00000079373
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111636
SMART Domains Protein: ENSMUSP00000107263
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111638
SMART Domains Protein: ENSMUSP00000107265
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 1.29e-4 SMART
PAC 361 404 3.66e0 SMART
low complexity region 417 428 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111639
SMART Domains Protein: ENSMUSP00000107266
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129788
SMART Domains Protein: ENSMUSP00000121170
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203818
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (Per, Arnt, Sim) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian Clock protein, the structurally related Mop4, and hypoxia-inducible factors, such as Hif1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Arntl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Arntl2 APN 6 146827329 splice site probably benign
IGL00481:Arntl2 APN 6 146809666 missense probably benign 0.11
IGL02141:Arntl2 APN 6 146828095 splice site probably benign
IGL02402:Arntl2 APN 6 146809768 missense possibly damaging 0.90
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0131:Arntl2 UTSW 6 146828103 missense probably benign 0.00
R0403:Arntl2 UTSW 6 146822655 missense probably damaging 1.00
R0716:Arntl2 UTSW 6 146829720 missense possibly damaging 0.82
R0834:Arntl2 UTSW 6 146822687 missense probably damaging 1.00
R1909:Arntl2 UTSW 6 146810810 missense probably benign 0.01
R2270:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R2272:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R3715:Arntl2 UTSW 6 146822689 missense probably damaging 0.97
R4370:Arntl2 UTSW 6 146809651 missense probably damaging 1.00
R5399:Arntl2 UTSW 6 146822661 missense probably damaging 0.99
R5894:Arntl2 UTSW 6 146823234 missense possibly damaging 0.93
R5972:Arntl2 UTSW 6 146809689 missense probably damaging 0.99
R6090:Arntl2 UTSW 6 146829696 missense possibly damaging 0.90
R6111:Arntl2 UTSW 6 146820599 missense probably benign 0.16
R6279:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6300:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6452:Arntl2 UTSW 6 146823207 missense probably benign 0.00
R6722:Arntl2 UTSW 6 146818900 missense probably damaging 0.99
R7296:Arntl2 UTSW 6 146822134 missense not run
R7335:Arntl2 UTSW 6 146809719 missense probably benign 0.01
R7481:Arntl2 UTSW 6 146818871 missense not run
R7655:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R7656:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R8015:Arntl2 UTSW 6 146820590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTGCGGCTTTCCTGTGAAG -3'
(R):5'- TCCCCTGAGAAACTGAGCTGTCAT -3'

Sequencing Primer
(F):5'- GCTTTCCTGTGAAGTTCTGC -3'
(R):5'- gctgctgtgttcctgcc -3'
Posted On2013-10-16