Incidental Mutation 'R0799:Zfp28'
ID76527
Institutional Source Beutler Lab
Gene Symbol Zfp28
Ensembl Gene ENSMUSG00000062861
Gene Namezinc finger protein 28
Synonymsmkr-5, 2810438M17Rik, Zfp-28
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6383295-6396915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6384183 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 73 (S73T)
Ref Sequence ENSEMBL: ENSMUSP00000079812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081022] [ENSMUST00000086323] [ENSMUST00000108559] [ENSMUST00000207314] [ENSMUST00000207347] [ENSMUST00000208030] [ENSMUST00000208390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081022
AA Change: S73T

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079812
Gene: ENSMUSG00000062861
AA Change: S73T

DomainStartEndE-ValueType
low complexity region 27 50 N/A INTRINSIC
KRAB 103 163 3.53e-33 SMART
ZnF_C2H2 377 399 3.95e-4 SMART
ZnF_C2H2 405 427 6.88e-4 SMART
ZnF_C2H2 433 456 1.2e-3 SMART
ZnF_C2H2 462 484 9.58e-3 SMART
ZnF_C2H2 490 512 2.57e-3 SMART
ZnF_C2H2 518 540 1.82e-3 SMART
ZnF_C2H2 546 568 2.4e-3 SMART
ZnF_C2H2 574 596 6.32e-3 SMART
ZnF_C2H2 602 624 1.38e-3 SMART
ZnF_C2H2 630 652 4.87e-4 SMART
ZnF_C2H2 658 680 2.91e-2 SMART
ZnF_C2H2 686 708 2.36e-2 SMART
ZnF_C2H2 714 736 6.42e-4 SMART
ZnF_C2H2 742 764 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086323
SMART Domains Protein: ENSMUSP00000083503
Gene: ENSMUSG00000055150

DomainStartEndE-ValueType
KRAB 14 74 1.07e-23 SMART
low complexity region 148 159 N/A INTRINSIC
ZnF_C2H2 173 195 3.39e-3 SMART
ZnF_C2H2 201 223 2.36e-2 SMART
ZnF_C2H2 229 251 3.63e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 307 3.95e-4 SMART
ZnF_C2H2 313 335 1.69e-3 SMART
ZnF_C2H2 341 363 5.21e-4 SMART
ZnF_C2H2 369 391 1.38e-3 SMART
ZnF_C2H2 397 419 9.88e-5 SMART
ZnF_C2H2 425 447 7.67e-2 SMART
ZnF_C2H2 453 475 6.32e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108559
SMART Domains Protein: ENSMUSP00000104199
Gene: ENSMUSG00000055150

DomainStartEndE-ValueType
KRAB 14 74 3.12e-34 SMART
low complexity region 180 191 N/A INTRINSIC
ZnF_C2H2 205 227 3.39e-3 SMART
ZnF_C2H2 233 255 2.36e-2 SMART
ZnF_C2H2 261 283 3.63e-3 SMART
ZnF_C2H2 289 311 3.89e-3 SMART
ZnF_C2H2 317 339 3.95e-4 SMART
ZnF_C2H2 345 367 1.69e-3 SMART
ZnF_C2H2 373 395 5.21e-4 SMART
ZnF_C2H2 401 423 1.38e-3 SMART
ZnF_C2H2 429 451 9.88e-5 SMART
ZnF_C2H2 457 479 7.67e-2 SMART
ZnF_C2H2 485 507 6.32e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207086
AA Change: S27T
Predicted Effect probably benign
Transcript: ENSMUST00000207314
Predicted Effect probably benign
Transcript: ENSMUST00000207347
Predicted Effect probably benign
Transcript: ENSMUST00000208030
Predicted Effect probably benign
Transcript: ENSMUST00000208390
Predicted Effect probably benign
Transcript: ENSMUST00000208949
Meta Mutation Damage Score 0.0969 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Zfp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Zfp28 APN 7 6393430 makesense probably null
IGL02300:Zfp28 APN 7 6389496 missense probably benign 0.00
IGL02541:Zfp28 APN 7 6393480 nonsense probably null
FR4340:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
FR4342:Zfp28 UTSW 7 6394863 missense probably damaging 1.00
R0442:Zfp28 UTSW 7 6394999 missense probably damaging 1.00
R0462:Zfp28 UTSW 7 6392240 missense possibly damaging 0.71
R1081:Zfp28 UTSW 7 6389780 missense possibly damaging 0.93
R1674:Zfp28 UTSW 7 6394943 missense possibly damaging 0.90
R1783:Zfp28 UTSW 7 6394792 missense probably damaging 1.00
R2119:Zfp28 UTSW 7 6394876 missense probably benign 0.00
R2186:Zfp28 UTSW 7 6394498 missense probably damaging 1.00
R4280:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4281:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4283:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4331:Zfp28 UTSW 7 6393701 missense probably benign 0.07
R4379:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4380:Zfp28 UTSW 7 6393442 missense probably benign 0.11
R4505:Zfp28 UTSW 7 6394161 missense probably damaging 1.00
R4659:Zfp28 UTSW 7 6393507 missense probably benign 0.05
R4706:Zfp28 UTSW 7 6389794 missense probably damaging 0.99
R5524:Zfp28 UTSW 7 6394851 unclassified probably null
R6269:Zfp28 UTSW 7 6393613 missense probably benign 0.00
R6981:Zfp28 UTSW 7 6394693 missense probably damaging 1.00
R7117:Zfp28 UTSW 7 6394462 missense probably damaging 1.00
R7176:Zfp28 UTSW 7 6383457 missense possibly damaging 0.49
R7312:Zfp28 UTSW 7 6383594 unclassified probably benign
R7422:Zfp28 UTSW 7 6394749 missense probably damaging 1.00
R7423:Zfp28 UTSW 7 6393957 missense probably damaging 1.00
R8110:Zfp28 UTSW 7 6389829 missense probably benign 0.02
Y4340:Zfp28 UTSW 7 6394657 missense probably damaging 1.00
Z1177:Zfp28 UTSW 7 6384187 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCTCGAAAGCTCAACTTGAGGCAG -3'
(R):5'- GCACCCAGGACAGGTCTCTTAAAC -3'

Sequencing Primer
(F):5'- gtcacaaccatccctaactcc -3'
(R):5'- GGACAGGTCTCTTAAACTGAAAAC -3'
Posted On2013-10-16