Incidental Mutation 'R0799:Ampd3'
ID76529
Institutional Source Beutler Lab
Gene Symbol Ampd3
Ensembl Gene ENSMUSG00000005686
Gene Nameadenosine monophosphate deaminase 3
Synonyms
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110768206-110812405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110800697 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 340 (F340L)
Ref Sequence ENSEMBL: ENSMUSP00000149655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005829] [ENSMUST00000170374] [ENSMUST00000213373]
Predicted Effect probably damaging
Transcript: ENSMUST00000005829
AA Change: F331L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005829
Gene: ENSMUSG00000005686
AA Change: F331L

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 1.5e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148367
Predicted Effect probably damaging
Transcript: ENSMUST00000170374
AA Change: F331L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130495
Gene: ENSMUSG00000005686
AA Change: F331L

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 7.6e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195971
Predicted Effect probably damaging
Transcript: ENSMUST00000213373
AA Change: F340L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9632 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the adenosine and AMP deaminases family. The encoded protein is an AMP deaminase involved in nucleotide and energy metabolism in erythrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean corpuscular volume, abnormal erythrocyte physiology including increased erythrocyte ATP levels and osmotic fragility after fasting, and increased lung inflammation after hind-limb ischemia andreperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Ampd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Ampd3 APN 7 110803147 missense probably benign 0.01
IGL00576:Ampd3 APN 7 110788821 splice site probably benign
IGL00805:Ampd3 APN 7 110809865 missense possibly damaging 0.78
IGL01486:Ampd3 APN 7 110809916 splice site probably benign
IGL01551:Ampd3 APN 7 110804976 missense probably damaging 1.00
IGL02088:Ampd3 APN 7 110793686 missense probably benign 0.00
IGL02123:Ampd3 APN 7 110802559 missense possibly damaging 0.91
IGL02605:Ampd3 APN 7 110795758 missense probably benign 0.00
IGL02990:Ampd3 APN 7 110807963 splice site probably benign
carson UTSW 7 110800710 missense probably damaging 1.00
commanche UTSW 7 110807871 missense possibly damaging 0.95
guangdong UTSW 7 110803162 missense probably damaging 1.00
penasco UTSW 7 110803226 missense probably damaging 1.00
taos UTSW 7 110804935 missense probably damaging 0.99
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0608:Ampd3 UTSW 7 110795790 missense probably damaging 1.00
R0608:Ampd3 UTSW 7 110795791 missense probably damaging 1.00
R0718:Ampd3 UTSW 7 110777808 missense probably damaging 1.00
R1053:Ampd3 UTSW 7 110788680 missense probably damaging 1.00
R1473:Ampd3 UTSW 7 110804935 missense probably damaging 0.99
R1676:Ampd3 UTSW 7 110795733 missense probably damaging 1.00
R1977:Ampd3 UTSW 7 110803162 missense probably damaging 1.00
R2380:Ampd3 UTSW 7 110800710 missense probably damaging 1.00
R2419:Ampd3 UTSW 7 110768369 unclassified probably benign
R3438:Ampd3 UTSW 7 110803226 missense probably damaging 1.00
R3907:Ampd3 UTSW 7 110793670 missense possibly damaging 0.88
R5367:Ampd3 UTSW 7 110807871 missense possibly damaging 0.95
R5625:Ampd3 UTSW 7 110802523 missense probably damaging 0.97
R6066:Ampd3 UTSW 7 110793767 missense probably benign 0.12
R6267:Ampd3 UTSW 7 110791180 splice site probably null
R6493:Ampd3 UTSW 7 110795811 splice site probably null
R6852:Ampd3 UTSW 7 110802546 missense probably benign 0.02
R7147:Ampd3 UTSW 7 110804852 missense probably damaging 1.00
R7313:Ampd3 UTSW 7 110806054 missense probably damaging 1.00
R7649:Ampd3 UTSW 7 110777842 missense probably benign 0.01
R7843:Ampd3 UTSW 7 110791188 missense probably benign 0.01
R8319:Ampd3 UTSW 7 110795775 missense probably benign 0.01
Z1088:Ampd3 UTSW 7 110777825 missense probably damaging 1.00
Z1177:Ampd3 UTSW 7 110788780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGGCAATGTGATACCACAGAG -3'
(R):5'- GCTTACTGCATGAACATCCAGCGAG -3'

Sequencing Primer
(F):5'- GCAGCCTTAATTCCAGGTTCAAG -3'
(R):5'- GTCCACCGTGAGGTCGTAG -3'
Posted On2013-10-16