Incidental Mutation 'R0799:Adgra2'
ID76532
Institutional Source Beutler Lab
Gene Symbol Adgra2
Ensembl Gene ENSMUSG00000031486
Gene Nameadhesion G protein-coupled receptor A2
SynonymsTem5, 8430414O08Rik, Gpr124, 9530074E10Rik
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27085583-27123436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27112495 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 362 (R362H)
Ref Sequence ENSEMBL: ENSMUSP00000136277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033876] [ENSMUST00000178514] [ENSMUST00000179351]
Predicted Effect probably damaging
Transcript: ENSMUST00000033876
AA Change: R362H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033876
Gene: ENSMUSG00000031486
AA Change: R362H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 1.06e2 SMART
LRR_TYP 107 130 2.71e-2 SMART
LRR_TYP 131 154 1.28e-3 SMART
LRR 155 178 7.38e1 SMART
LRRCT 190 240 4.63e-6 SMART
IG 253 346 3.49e-3 SMART
low complexity region 629 639 N/A INTRINSIC
low complexity region 663 674 N/A INTRINSIC
Pfam:GPS 709 750 1.1e-7 PFAM
Pfam:7tm_2 770 990 5.3e-13 PFAM
transmembrane domain 1016 1038 N/A INTRINSIC
transmembrane domain 1045 1064 N/A INTRINSIC
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1110 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178514
AA Change: R362H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136277
Gene: ENSMUSG00000031486
AA Change: R362H

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LRR 82 106 4.4e-1 SMART
LRR_TYP 107 130 1.1e-4 SMART
LRR_TYP 131 154 5.3e-6 SMART
LRR 155 178 3.1e-1 SMART
LRRCT 190 240 2.2e-8 SMART
IG 253 346 1.4e-5 SMART
HormR 349 426 1.8e-4 SMART
Pfam:7tm_2 554 775 3.2e-11 PFAM
transmembrane domain 801 823 N/A INTRINSIC
transmembrane domain 830 849 N/A INTRINSIC
low complexity region 860 880 N/A INTRINSIC
low complexity region 895 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179207
Predicted Effect probably benign
Transcript: ENSMUST00000179351
SMART Domains Protein: ENSMUSP00000137457
Gene: ENSMUSG00000031486

DomainStartEndE-ValueType
Pfam:GPS 5 49 4.5e-11 PFAM
transmembrane domain 67 89 N/A INTRINSIC
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display fetal or perinatal lethality with CNS hemorrhage and angiogenic arrest in the CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Adgra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Adgra2 APN 8 27085983 missense possibly damaging 0.81
IGL01599:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01627:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01629:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01632:Adgra2 APN 8 27118733 missense possibly damaging 0.67
IGL01968:Adgra2 APN 8 27121235 nonsense probably null
IGL02551:Adgra2 APN 8 27119222 missense probably benign
IGL02820:Adgra2 APN 8 27117507 missense probably damaging 1.00
R0735:Adgra2 UTSW 8 27117318 missense probably damaging 1.00
R1183:Adgra2 UTSW 8 27114388 missense probably damaging 1.00
R1276:Adgra2 UTSW 8 27119824 missense probably damaging 0.99
R1389:Adgra2 UTSW 8 27111088 missense probably damaging 1.00
R1514:Adgra2 UTSW 8 27121278 nonsense probably null
R1601:Adgra2 UTSW 8 27110018 splice site probably null
R1760:Adgra2 UTSW 8 27119767 missense probably damaging 1.00
R1957:Adgra2 UTSW 8 27111168 missense possibly damaging 0.64
R1977:Adgra2 UTSW 8 27115761 missense possibly damaging 0.80
R2164:Adgra2 UTSW 8 27114204 nonsense probably null
R2181:Adgra2 UTSW 8 27121673 missense probably damaging 0.99
R4282:Adgra2 UTSW 8 27119244 missense possibly damaging 0.54
R4724:Adgra2 UTSW 8 27098822 missense possibly damaging 0.91
R4749:Adgra2 UTSW 8 27114197 missense probably damaging 1.00
R4809:Adgra2 UTSW 8 27110479 nonsense probably null
R5718:Adgra2 UTSW 8 27113486 critical splice donor site probably null
R6025:Adgra2 UTSW 8 27114463 missense probably damaging 0.99
R6078:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6079:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6138:Adgra2 UTSW 8 27114429 missense probably damaging 1.00
R6140:Adgra2 UTSW 8 27115405 missense probably damaging 1.00
R6232:Adgra2 UTSW 8 27119165 missense probably benign 0.19
R6321:Adgra2 UTSW 8 27114162 missense probably benign 0.02
R6385:Adgra2 UTSW 8 27118850 missense probably damaging 1.00
R6676:Adgra2 UTSW 8 27111240 missense possibly damaging 0.50
R6724:Adgra2 UTSW 8 27114182 missense possibly damaging 0.93
R6862:Adgra2 UTSW 8 27113436 missense probably benign 0.01
R6862:Adgra2 UTSW 8 27113437 missense probably damaging 0.98
R7140:Adgra2 UTSW 8 27120901 critical splice donor site probably null
R7242:Adgra2 UTSW 8 27122027 missense probably damaging 1.00
R7861:Adgra2 UTSW 8 27114457 missense probably damaging 0.98
R7882:Adgra2 UTSW 8 27117412 missense probably benign 0.15
R8069:Adgra2 UTSW 8 27119223 missense probably benign 0.01
R8146:Adgra2 UTSW 8 27114174 missense probably damaging 0.99
X0050:Adgra2 UTSW 8 27113418 missense probably benign 0.32
X0062:Adgra2 UTSW 8 27120806 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GTGAGCTGACCCTGTCTCACATTG -3'
(R):5'- GGGCCTCTTTTGCATACCAAAATGG -3'

Sequencing Primer
(F):5'- CATTGGTGTGTGGGCCTC -3'
(R):5'- tgccctcttcttgtgtgtc -3'
Posted On2013-10-16