Incidental Mutation 'R0799:Eps15l1'
ID76534
Institutional Source Beutler Lab
Gene Symbol Eps15l1
Ensembl Gene ENSMUSG00000006276
Gene Nameepidermal growth factor receptor pathway substrate 15-like 1
Synonyms9830147J04Rik, Eps15-rs, Eps15R
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72340999-72421460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72346085 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 821 (D821N)
Ref Sequence ENSEMBL: ENSMUSP00000129739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163643] [ENSMUST00000212121]
Predicted Effect probably damaging
Transcript: ENSMUST00000163643
AA Change: D821N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129739
Gene: ENSMUSG00000006276
AA Change: D821N

DomainStartEndE-ValueType
EH 8 103 1.45e-21 SMART
EFh 52 80 6.56e0 SMART
EH 120 214 6.1e-47 SMART
EFh 163 191 4.35e-2 SMART
low complexity region 241 255 N/A INTRINSIC
EH 266 362 5.08e-44 SMART
EFh 276 304 1.09e0 SMART
coiled coil region 381 564 N/A INTRINSIC
internal_repeat_2 615 656 1.56e-6 PROSPERO
low complexity region 661 678 N/A INTRINSIC
low complexity region 701 722 N/A INTRINSIC
low complexity region 728 743 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
low complexity region 775 790 N/A INTRINSIC
internal_repeat_2 809 839 1.56e-6 PROSPERO
low complexity region 840 853 N/A INTRINSIC
UIM 863 882 3.98e1 SMART
UIM 889 907 3.76e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212257
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Eps15l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Eps15l1 APN 8 72384838 nonsense probably null
IGL01316:Eps15l1 APN 8 72389414 missense possibly damaging 0.66
IGL01344:Eps15l1 APN 8 72382325 critical splice donor site probably null
IGL01918:Eps15l1 APN 8 72367912 missense possibly damaging 0.49
IGL01982:Eps15l1 APN 8 72379075 missense probably benign 0.28
IGL02305:Eps15l1 APN 8 72387009 missense probably null 1.00
IGL02939:Eps15l1 APN 8 72384762 splice site probably benign
IGL02951:Eps15l1 APN 8 72358396 missense probably benign 0.19
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0025:Eps15l1 UTSW 8 72381497 splice site probably benign
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R0030:Eps15l1 UTSW 8 72373050 missense probably benign 0.03
R1300:Eps15l1 UTSW 8 72391902 missense probably damaging 0.99
R2131:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2132:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R2133:Eps15l1 UTSW 8 72386868 missense probably benign 0.05
R3693:Eps15l1 UTSW 8 72399060 splice site probably benign
R4072:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4074:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4076:Eps15l1 UTSW 8 72380284 missense probably damaging 1.00
R4485:Eps15l1 UTSW 8 72399687 missense possibly damaging 0.78
R4592:Eps15l1 UTSW 8 72341394 missense probably damaging 0.96
R4606:Eps15l1 UTSW 8 72373916 missense possibly damaging 0.69
R4981:Eps15l1 UTSW 8 72378989 critical splice donor site probably null
R5496:Eps15l1 UTSW 8 72382775 missense probably benign 0.00
R5502:Eps15l1 UTSW 8 72378992 intron probably null
R5682:Eps15l1 UTSW 8 72371748 nonsense probably null
R6326:Eps15l1 UTSW 8 72341434 nonsense probably null
R6384:Eps15l1 UTSW 8 72368710 critical splice donor site probably null
R7305:Eps15l1 UTSW 8 72373034 missense probably benign
R7500:Eps15l1 UTSW 8 72382790 missense probably damaging 1.00
R7732:Eps15l1 UTSW 8 72380976 missense probably damaging 1.00
Z1088:Eps15l1 UTSW 8 72386901 missense probably damaging 0.99
Z1177:Eps15l1 UTSW 8 72373078 critical splice acceptor site probably null
Z1177:Eps15l1 UTSW 8 72381437 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGCCTTACAGAAGCCATCGCAG -3'
(R):5'- AAATCACTCTCCTGGCATGACCTTG -3'

Sequencing Primer
(F):5'- GCAAAGCAGTGTCCATAGC -3'
(R):5'- TGCTCTCCCTAGAGAGACAG -3'
Posted On2013-10-16