Incidental Mutation 'R0799:Olfr911-ps1'
ID76536
Institutional Source Beutler Lab
Gene Symbol Olfr911-ps1
Ensembl Gene ENSMUSG00000062621
Gene Nameolfactory receptor 911, pseudogene 1
SynonymsMOR165-1, MOR166-1, GA_x6K02T2PVTD-32247224-32248163, GA_x6K02T2PVTD-32223906-32224841, Olfr909
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38521580-38527133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38524141 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 136 (M136I)
Ref Sequence ENSEMBL: ENSMUSP00000150446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074987] [ENSMUST00000216496]
Predicted Effect probably benign
Transcript: ENSMUST00000074987
AA Change: M136I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000074515
Gene: ENSMUSG00000062621
AA Change: M136I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 9.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216496
AA Change: M136I

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Olfr911-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Olfr911-ps1 APN 9 38523733 utr 5 prime probably benign
IGL02319:Olfr911-ps1 APN 9 38523870 missense probably damaging 0.97
IGL02415:Olfr911-ps1 APN 9 38524112 missense probably benign 0.42
IGL02536:Olfr911-ps1 APN 9 38524164 missense probably damaging 1.00
IGL02702:Olfr911-ps1 APN 9 38524560 missense probably damaging 1.00
IGL02926:Olfr911-ps1 APN 9 38523725 utr 5 prime probably benign
R0499:Olfr911-ps1 UTSW 9 38524505 missense probably benign 0.01
R0662:Olfr911-ps1 UTSW 9 38524026 missense probably damaging 0.99
R1186:Olfr911-ps1 UTSW 9 38524157 missense probably damaging 0.97
R1681:Olfr911-ps1 UTSW 9 38524117 missense probably benign 0.03
R3522:Olfr911-ps1 UTSW 9 38523785 missense probably damaging 1.00
R5820:Olfr911-ps1 UTSW 9 38524599 missense possibly damaging 0.52
R6597:Olfr911-ps1 UTSW 9 38524004 missense probably benign 0.00
R7721:Olfr911-ps1 UTSW 9 38523717 critical splice acceptor site probably null
R7846:Olfr911-ps1 UTSW 9 38524379 missense probably benign 0.00
Z1088:Olfr911-ps1 UTSW 9 38523859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAACAACAGCAGTGGGGAATTTG -3'
(R):5'- GGGTTCATCATGGGAACCACAATGG -3'

Sequencing Primer
(F):5'- GGCTTTGATCACTTTAATTGCACTG -3'
(R):5'- CTACAGGTGCTAAATGCTTTGGAC -3'
Posted On2013-10-16