Incidental Mutation 'R0799:Cdk4'
ID76539
Institutional Source Beutler Lab
Gene Symbol Cdk4
Ensembl Gene ENSMUSG00000006728
Gene Namecyclin-dependent kinase 4
SynonymsCrk3, p34/cdk4
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127063534-127067920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127064994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 172 (T172A)
Ref Sequence ENSEMBL: ENSMUSP00000117234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]
Predicted Effect probably damaging
Transcript: ENSMUST00000006911
AA Change: T172A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: T172A

DomainStartEndE-ValueType
S_TKc 6 295 9.2e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040307
SMART Domains Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
RINGv 109 156 7.51e-18 SMART
transmembrane domain 183 205 N/A INTRINSIC
Blast:AAA 211 238 2e-9 BLAST
low complexity region 267 284 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000060991
SMART Domains Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 200 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120226
SMART Domains Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 103 6e-10 PFAM
low complexity region 121 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123456
Predicted Effect probably damaging
Transcript: ENSMUST00000125682
AA Change: T172A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: T172A

DomainStartEndE-ValueType
S_TKc 6 261 5.19e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133115
AA Change: T172A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728
AA Change: T172A

DomainStartEndE-ValueType
S_TKc 6 250 1.55e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140254
Predicted Effect probably benign
Transcript: ENSMUST00000142558
SMART Domains Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

DomainStartEndE-ValueType
Pfam:Pkinase 6 74 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220344
Meta Mutation Damage Score 0.8360 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Cdk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Cdk4 APN 10 127064297 missense probably damaging 1.00
IGL01326:Cdk4 APN 10 127064623 missense possibly damaging 0.95
R0140:Cdk4 UTSW 10 127064345 missense probably damaging 1.00
R1437:Cdk4 UTSW 10 127064689 missense probably damaging 1.00
R1575:Cdk4 UTSW 10 127064651 missense probably damaging 1.00
R1656:Cdk4 UTSW 10 127064980 missense probably benign 0.00
R1761:Cdk4 UTSW 10 127064677 unclassified probably null
R2567:Cdk4 UTSW 10 127064276 missense probably benign 0.01
R4679:Cdk4 UTSW 10 127064911 missense possibly damaging 0.93
R4790:Cdk4 UTSW 10 127064701 missense probably damaging 1.00
R4897:Cdk4 UTSW 10 127064575 intron probably benign
R4946:Cdk4 UTSW 10 127064890 unclassified probably null
R5755:Cdk4 UTSW 10 127064722 critical splice donor site probably null
R6515:Cdk4 UTSW 10 127066183 missense probably null 0.06
R6868:Cdk4 UTSW 10 127065001 missense probably benign 0.43
R7488:Cdk4 UTSW 10 127064237 start codon destroyed probably null 0.26
R7748:Cdk4 UTSW 10 127064429 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CTGAGGACATACCTGGACAAAGCAC -3'
(R):5'- GTACCAGAGCGTAACCACCTGAAG -3'

Sequencing Primer
(F):5'- CTGCCGGTTGAGACCATTAAG -3'
(R):5'- CGTAACCACCTGAAGAGAATAGTAG -3'
Posted On2013-10-16