Incidental Mutation 'R0799:Map3k9'
ID76540
Institutional Source Beutler Lab
Gene Symbol Map3k9
Ensembl Gene ENSMUSG00000042724
Gene Namemitogen-activated protein kinase kinase kinase 9
SynonymsMlk1
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81721010-81781175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81722269 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1025 (P1025S)
Ref Sequence ENSEMBL: ENSMUSP00000152201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035987] [ENSMUST00000222322]
Predicted Effect probably benign
Transcript: ENSMUST00000035987
AA Change: P1002S

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041819
Gene: ENSMUSG00000042724
AA Change: P1002S

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
SH3 48 108 1.61e-20 SMART
TyrKc 137 396 6.72e-89 SMART
low complexity region 449 469 N/A INTRINSIC
low complexity region 573 590 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 736 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
low complexity region 901 915 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221438
Predicted Effect probably benign
Transcript: ENSMUST00000222322
AA Change: P1025S

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Map3k9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Map3k9 APN 12 81729698 missense probably benign 0.00
IGL01098:Map3k9 APN 12 81724154 missense probably damaging 1.00
IGL01122:Map3k9 APN 12 81732126 missense possibly damaging 0.94
IGL01680:Map3k9 APN 12 81724739 missense probably benign 0.10
IGL01997:Map3k9 APN 12 81772697 missense probably damaging 1.00
IGL02178:Map3k9 APN 12 81743837 missense probably damaging 1.00
IGL02724:Map3k9 APN 12 81724742 missense probably benign
PIT4366001:Map3k9 UTSW 12 81772761 missense possibly damaging 0.95
R0530:Map3k9 UTSW 12 81722482 missense probably benign 0.00
R0541:Map3k9 UTSW 12 81734223 missense possibly damaging 0.79
R0550:Map3k9 UTSW 12 81725781 missense probably damaging 1.00
R1730:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1783:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1859:Map3k9 UTSW 12 81724482 missense possibly damaging 0.82
R1917:Map3k9 UTSW 12 81780790 nonsense probably null
R3121:Map3k9 UTSW 12 81743924 missense probably damaging 1.00
R3779:Map3k9 UTSW 12 81743791 splice site probably benign
R3931:Map3k9 UTSW 12 81772917 missense probably damaging 0.99
R3951:Map3k9 UTSW 12 81722521 missense probably benign
R4571:Map3k9 UTSW 12 81734091 missense probably benign 0.25
R4728:Map3k9 UTSW 12 81722373 missense probably damaging 0.96
R4857:Map3k9 UTSW 12 81724627 missense probably benign 0.42
R4882:Map3k9 UTSW 12 81724162 missense probably damaging 1.00
R5077:Map3k9 UTSW 12 81734077 splice site probably null
R5369:Map3k9 UTSW 12 81722052 missense probably damaging 0.98
R5418:Map3k9 UTSW 12 81743817 nonsense probably null
R5540:Map3k9 UTSW 12 81772813 missense probably damaging 1.00
R5567:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5570:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5696:Map3k9 UTSW 12 81734122 missense probably benign 0.00
R6539:Map3k9 UTSW 12 81732192 missense probably damaging 0.98
R6542:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6816:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6964:Map3k9 UTSW 12 81773003 missense probably benign 0.00
R7027:Map3k9 UTSW 12 81730624 missense probably benign 0.06
R7055:Map3k9 UTSW 12 81724208 missense probably damaging 0.99
R7082:Map3k9 UTSW 12 81724702 missense probably damaging 1.00
R7247:Map3k9 UTSW 12 81725830 missense possibly damaging 0.65
R7424:Map3k9 UTSW 12 81724097 missense probably benign 0.00
R7476:Map3k9 UTSW 12 81743808 missense probably damaging 1.00
R7638:Map3k9 UTSW 12 81724732 missense probably benign 0.00
R8098:Map3k9 UTSW 12 81734114 missense probably damaging 0.99
R8249:Map3k9 UTSW 12 81780777 missense unknown
X0025:Map3k9 UTSW 12 81724412 missense possibly damaging 0.58
Z1176:Map3k9 UTSW 12 81772782 missense possibly damaging 0.76
Z1177:Map3k9 UTSW 12 81722279 missense probably damaging 0.99
Z1177:Map3k9 UTSW 12 81780846 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCATTCAGCTCAGCTCTGCATAG -3'
(R):5'- TGTTGAAAACTCCCAGTCCCAGCC -3'

Sequencing Primer
(F):5'- CATAGGGGCACAGTGCTATC -3'
(R):5'- CGAGACCCAGGTGAATTTCC -3'
Posted On2013-10-16