Incidental Mutation 'R0799:Rpp40'
ID76541
Institutional Source Beutler Lab
Gene Symbol Rpp40
Ensembl Gene ENSMUSG00000021418
Gene Nameribonuclease P 40 subunit
SynonymsD8Bwg1265e, Rnasep1
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location35893472-35906359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35902051 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 109 (R109H)
Ref Sequence ENSEMBL: ENSMUSP00000134228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171686] [ENSMUST00000174230]
Predicted Effect probably benign
Transcript: ENSMUST00000171686
AA Change: R132H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130290
Gene: ENSMUSG00000021418
AA Change: R132H

DomainStartEndE-ValueType
Pfam:Ribonuc_P_40 75 346 1.9e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174230
AA Change: R109H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134228
Gene: ENSMUSG00000021418
AA Change: R109H

DomainStartEndE-ValueType
Pfam:Ribonuc_P_40 85 324 1.7e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174231
SMART Domains Protein: ENSMUSP00000134210
Gene: ENSMUSG00000021418

DomainStartEndE-ValueType
Pfam:Ribonuc_P_40 19 67 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225277
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Rpp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Rpp40 APN 13 35902034 missense probably damaging 1.00
IGL01550:Rpp40 APN 13 35906200 splice site probably null
IGL03028:Rpp40 APN 13 35904511 missense probably damaging 0.99
R0006:Rpp40 UTSW 13 35896735 missense probably damaging 1.00
R0098:Rpp40 UTSW 13 35898987 missense probably benign 0.06
R0098:Rpp40 UTSW 13 35898987 missense probably benign 0.06
R0144:Rpp40 UTSW 13 35901369 missense probably benign 0.00
R1852:Rpp40 UTSW 13 35896914 missense probably benign 0.06
R2083:Rpp40 UTSW 13 35898992 missense probably benign 0.01
R2129:Rpp40 UTSW 13 35898621 nonsense probably null
R4042:Rpp40 UTSW 13 35898566 missense probably benign 0.00
R4044:Rpp40 UTSW 13 35898566 missense probably benign 0.00
R4118:Rpp40 UTSW 13 35896804 missense probably damaging 1.00
R5068:Rpp40 UTSW 13 35898698 missense probably benign 0.00
R5181:Rpp40 UTSW 13 35896712 unclassified probably null
R7023:Rpp40 UTSW 13 35898906 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCCCTTATAAAATGTGGTGTACAGCCAA -3'
(R):5'- TCCCCGACATTTCACTGCTCAGA -3'

Sequencing Primer
(F):5'- GAAGTGCAACCAATAGCTCCTTG -3'
(R):5'- GATGTCTAGCTTTCTTAGAGAACACC -3'
Posted On2013-10-16