Incidental Mutation 'R0799:Adamts6'
ID76542
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonymsb2b2187.1Clo, b2b2182Clo, ADAM-TS6, b2b2029Clo, b2b1879.1Clo, b2b2228Clo, A930019D11Rik
MMRRC Submission 038979-MU
Accession Numbers

NCBI RefSeq: NM_001081020.1; MGI: 1347348

Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104287835-104496695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104314271 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 321 (S321P)
Ref Sequence ENSEMBL: ENSMUSP00000153665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224504] [ENSMUST00000224742] [ENSMUST00000224784]
Predicted Effect probably damaging
Transcript: ENSMUST00000065766
AA Change: S321P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: S321P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223562
AA Change: S321P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224208
AA Change: S321P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224504
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect probably damaging
Transcript: ENSMUST00000224784
AA Change: S321P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5033 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104429790 missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104297218 nonsense probably null
IGL01305:Adamts6 APN 13 104390082 missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104297164 missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104390192 splice site probably benign
IGL01678:Adamts6 APN 13 104313688 missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104390135 missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104313660 missense probably null 1.00
IGL02217:Adamts6 APN 13 104462365 splice site probably benign
IGL02828:Adamts6 APN 13 104297470 missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104297275 missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104444956 utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104444215 missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104314334 missense possibly damaging 0.77
De_vito UTSW 13 104347392 critical splice donor site probably null
ANU22:Adamts6 UTSW 13 104390082 missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104297491 missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104390076 critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104426930 splice site probably benign
R0549:Adamts6 UTSW 13 104297255 missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104444927 missense probably benign 0.00
R0703:Adamts6 UTSW 13 104352847 missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104413789 missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104312881 missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104493637 missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104444875 missense probably benign 0.26
R1619:Adamts6 UTSW 13 104312777 missense probably benign 0.14
R1727:Adamts6 UTSW 13 104428964 splice site probably benign
R1967:Adamts6 UTSW 13 104426951 nonsense probably null
R2013:Adamts6 UTSW 13 104314304 missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104462238 missense probably benign 0.00
R2432:Adamts6 UTSW 13 104426977 missense probably benign 0.01
R3118:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104312904 missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104444128 nonsense probably null
R4841:Adamts6 UTSW 13 104312787 missense probably benign 0.00
R4976:Adamts6 UTSW 13 104297490 missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104307243 missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104493622 missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104352815 missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104347350 missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104479535 missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104297425 missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104347392 critical splice donor site probably null
R6243:Adamts6 UTSW 13 104314301 missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104462282 missense probably benign
R6743:Adamts6 UTSW 13 104428928 missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104313652 missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104312759 missense probably benign
R7351:Adamts6 UTSW 13 104390112 missense possibly damaging 0.63
R7520:Adamts6 UTSW 13 104297186 missense probably benign 0.01
R7866:Adamts6 UTSW 13 104413749 nonsense probably null
R7949:Adamts6 UTSW 13 104413749 nonsense probably null
R8274:Adamts6 UTSW 13 104313673 missense probably benign 0.02
X0065:Adamts6 UTSW 13 104493628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTGCAAGGAAAGTCTGTTCAGTAA -3'
(R):5'- AATGCACAACGAATCTCCTCTTCCC -3'

Sequencing Primer
(F):5'- GTCAGATGTTCTGGAGATAAAAATCG -3'
(R):5'- CCCTTATTACCTGAAAGAGGTGTAG -3'
Posted On2013-10-16