Incidental Mutation 'R0799:Ube2e2'
ID76544
Institutional Source Beutler Lab
Gene Symbol Ube2e2
Ensembl Gene ENSMUSG00000058317
Gene Nameubiquitin-conjugating enzyme E2E 2
Synonyms
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location18573575-18894267 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 18630393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 56 (S56*)
Ref Sequence ENSEMBL: ENSMUSP00000135622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076133] [ENSMUST00000124353] [ENSMUST00000150727] [ENSMUST00000151926] [ENSMUST00000175643] [ENSMUST00000176555] [ENSMUST00000176843]
Predicted Effect probably null
Transcript: ENSMUST00000076133
AA Change: S89*
SMART Domains Protein: ENSMUSP00000075495
Gene: ENSMUSG00000058317
AA Change: S89*

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
UBCc 58 201 2.41e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124353
AA Change: S89*
SMART Domains Protein: ENSMUSP00000114162
Gene: ENSMUSG00000058317
AA Change: S89*

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
Pfam:UQ_con 59 108 1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135381
Predicted Effect probably null
Transcript: ENSMUST00000150727
AA Change: S89*
SMART Domains Protein: ENSMUSP00000115738
Gene: ENSMUSG00000058317
AA Change: S89*

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
UBCc 58 201 2.41e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151926
AA Change: S113*
SMART Domains Protein: ENSMUSP00000118321
Gene: ENSMUSG00000058317
AA Change: S113*

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
UBCc 82 181 6.81e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175643
AA Change: S55*
SMART Domains Protein: ENSMUSP00000135674
Gene: ENSMUSG00000058317
AA Change: S55*

DomainStartEndE-ValueType
UBCc 10 167 9.19e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176555
SMART Domains Protein: ENSMUSP00000134919
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:3BZH|A 28 84 8e-6 PDB
SCOP:d2e2c__ 49 85 5e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176843
AA Change: S56*
SMART Domains Protein: ENSMUSP00000135622
Gene: ENSMUSG00000058317
AA Change: S56*

DomainStartEndE-ValueType
UBCc 7 146 1.09e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177259
SMART Domains Protein: ENSMUSP00000135573
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
Pfam:UQ_con 59 118 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177398
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Ube2e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P4717OSA:Ube2e2 UTSW 14 18630297 critical splice donor site probably null
P4748:Ube2e2 UTSW 14 18630297 critical splice donor site probably null
R0717:Ube2e2 UTSW 14 18888435 missense probably benign 0.00
R1671:Ube2e2 UTSW 14 18586889 missense probably damaging 1.00
R2973:Ube2e2 UTSW 14 18630321 missense possibly damaging 0.96
R5941:Ube2e2 UTSW 14 18586910 missense probably damaging 1.00
R7397:Ube2e2 UTSW 14 18630339 missense probably damaging 1.00
R7657:Ube2e2 UTSW 14 18586997 missense probably benign 0.30
R8027:Ube2e2 UTSW 14 18574317 missense possibly damaging 0.54
X0018:Ube2e2 UTSW 14 18586923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGAAGCTGCCTATGCCAAC -3'
(R):5'- AGGACCTTCGACTCTGCTGGATTAC -3'

Sequencing Primer
(F):5'- TGCCTATGCCAACAGAGC -3'
(R):5'- CGACTCTGCTGGATTACATAATGC -3'
Posted On2013-10-16