Incidental Mutation 'R0799:Trim35'
ID76546
Institutional Source Beutler Lab
Gene Symbol Trim35
Ensembl Gene ENSMUSG00000022043
Gene Nametripartite motif-containing 35
SynonymsHls5, Mair, A430106H13Rik, 0710005M05Rik
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66297031-66311424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66309201 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 472 (H472Q)
Ref Sequence ENSEMBL: ENSMUSP00000022623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022623]
Predicted Effect probably damaging
Transcript: ENSMUST00000022623
AA Change: H472Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: H472Q

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
RING 36 75 6.89e-8 SMART
BBOX 111 152 1.27e-6 SMART
coiled coil region 219 267 N/A INTRINSIC
PRY 316 367 4.41e-15 SMART
Pfam:SPRY 370 495 3.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121006
SMART Domains Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
RING 30 69 6.89e-8 SMART
BBOX 105 146 1.27e-6 SMART
coiled coil region 212 260 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Trim35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Trim35 APN 14 66308801 missense probably damaging 1.00
IGL02398:Trim35 APN 14 66309248 missense probably damaging 1.00
IGL03132:Trim35 APN 14 66309146 missense probably damaging 1.00
R0759:Trim35 UTSW 14 66308787 missense probably benign 0.02
R0848:Trim35 UTSW 14 66309125 missense probably benign 0.01
R1170:Trim35 UTSW 14 66308799 missense probably benign 0.35
R1734:Trim35 UTSW 14 66309329 missense probably damaging 0.99
R1751:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R1767:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R2259:Trim35 UTSW 14 66309262 nonsense probably null
R3963:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R4572:Trim35 UTSW 14 66307873 missense probably damaging 1.00
R5068:Trim35 UTSW 14 66308972 unclassified probably benign
R5069:Trim35 UTSW 14 66308972 unclassified probably benign
R5070:Trim35 UTSW 14 66308972 unclassified probably benign
R5372:Trim35 UTSW 14 66297266 missense possibly damaging 0.69
R5886:Trim35 UTSW 14 66304053 missense possibly damaging 0.92
R5886:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R6018:Trim35 UTSW 14 66308750 missense probably damaging 1.00
R6165:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R6326:Trim35 UTSW 14 66303204 missense possibly damaging 0.52
R6476:Trim35 UTSW 14 66308795 missense probably damaging 1.00
R7084:Trim35 UTSW 14 66308822 missense probably damaging 0.98
R7192:Trim35 UTSW 14 66297446 missense probably damaging 1.00
R7350:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R7546:Trim35 UTSW 14 66303247 missense probably benign 0.02
R7644:Trim35 UTSW 14 66297097 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAGGCTCTCAAGTGTTCTCCAAG -3'
(R):5'- CCCACATCCTGAAGGTAGCATGAC -3'

Sequencing Primer
(F):5'- AAGTGTTCTCCAAGGGCTCC -3'
(R):5'- GCTCCTAACTTTGGAGCTACAG -3'
Posted On2013-10-16