Incidental Mutation 'R0799:Gtpbp1'
ID76550
Institutional Source Beutler Lab
Gene Symbol Gtpbp1
Ensembl Gene ENSMUSG00000042535
Gene NameGTP binding protein 1
SynonymsGP-1, GTPBP1
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79690845-79721479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79716200 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 445 (I445V)
Ref Sequence ENSEMBL: ENSMUSP00000043575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046463] [ENSMUST00000230262] [ENSMUST00000231095]
PDB Structure
Murine Alloreactive ScFv TCR-Peptide-MHC Class I Molecule Complex [X-RAY DIFFRACTION]
Mhc Class I H-2Kb molecule complexed with pKB1 peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000046463
AA Change: I445V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043575
Gene: ENSMUSG00000042535
AA Change: I445V

DomainStartEndE-ValueType
low complexity region 28 37 N/A INTRINSIC
Pfam:GTP_EFTU 160 385 2.7e-24 PFAM
low complexity region 402 420 N/A INTRINSIC
SCOP:d1exma2 491 575 4e-19 SMART
low complexity region 605 619 N/A INTRINSIC
low complexity region 645 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228991
Predicted Effect probably benign
Transcript: ENSMUST00000229583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230023
Predicted Effect probably benign
Transcript: ENSMUST00000230262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230496
Predicted Effect probably benign
Transcript: ENSMUST00000231095
Meta Mutation Damage Score 0.4649 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted null mutation were viable and fertile with no obvious morphological or behavioral defects. In addition, no defects in macrophage function were observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Gtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Gtpbp1 APN 15 79719136 missense possibly damaging 0.90
IGL01783:Gtpbp1 APN 15 79716197 missense probably damaging 1.00
IGL01794:Gtpbp1 APN 15 79716246 missense probably damaging 1.00
IGL01859:Gtpbp1 APN 15 79719140 missense probably benign
IGL02245:Gtpbp1 APN 15 79690926 missense probably benign 0.02
IGL02532:Gtpbp1 APN 15 79720077 missense probably benign 0.05
IGL02730:Gtpbp1 APN 15 79719171 missense probably benign
IGL02796:Gtpbp1 UTSW 15 79716985 missense possibly damaging 0.83
R0525:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0531:Gtpbp1 UTSW 15 79720091 missense probably damaging 1.00
R0535:Gtpbp1 UTSW 15 79707732 missense probably damaging 1.00
R0665:Gtpbp1 UTSW 15 79713447 missense probably benign 0.09
R0760:Gtpbp1 UTSW 15 79719155 missense probably damaging 0.99
R1445:Gtpbp1 UTSW 15 79713448 missense possibly damaging 0.82
R1458:Gtpbp1 UTSW 15 79707729 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1462:Gtpbp1 UTSW 15 79707885 missense probably damaging 1.00
R1498:Gtpbp1 UTSW 15 79719021 splice site probably null
R1567:Gtpbp1 UTSW 15 79712190 missense probably damaging 0.98
R3028:Gtpbp1 UTSW 15 79715879 missense possibly damaging 0.64
R4431:Gtpbp1 UTSW 15 79716197 missense probably damaging 1.00
R4583:Gtpbp1 UTSW 15 79715951 missense possibly damaging 0.64
R4854:Gtpbp1 UTSW 15 79719205 missense probably benign
R4925:Gtpbp1 UTSW 15 79715968 missense probably benign 0.23
R5023:Gtpbp1 UTSW 15 79719221 missense possibly damaging 0.49
R5052:Gtpbp1 UTSW 15 79715969 missense probably damaging 1.00
R5695:Gtpbp1 UTSW 15 79712174 unclassified probably null
R6009:Gtpbp1 UTSW 15 79712096 missense probably damaging 1.00
R6089:Gtpbp1 UTSW 15 79706997 missense probably benign 0.15
R7088:Gtpbp1 UTSW 15 79719282 missense
R7343:Gtpbp1 UTSW 15 79691042 missense probably benign 0.03
R7383:Gtpbp1 UTSW 15 79716153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGCTCAAGATGTTCCTCAACC -3'
(R):5'- TGCAGCCACAAGAACTGGAGAC -3'

Sequencing Primer
(F):5'- CCTGCTGAGTTCCAGATAGATGAC -3'
(R):5'- CTGGAGACAGCAGACTACG -3'
Posted On2013-10-16