Incidental Mutation 'R0799:Poglut1'
ID76555
Institutional Source Beutler Lab
Gene Symbol Poglut1
Ensembl Gene ENSMUSG00000034064
Gene Nameprotein O-glucosyltransferase 1
SynonymsRumi, Ktelc1, 9630046K23Rik
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38525137-38550258 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 38534721 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036210]
Predicted Effect probably null
Transcript: ENSMUST00000036210
SMART Domains Protein: ENSMUSP00000038166
Gene: ENSMUSG00000034064

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CAP10 121 373 6.69e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153187
Meta Mutation Damage Score 0.6252 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a protein that can catalyze transfer of either UDP-glucose or UDP-xylose to epidermal growth factor (EGF) repeats, such as those found in Notch. Loss of this gene product results in embryonic lethality. Embryos have neural plate defects, heart defects, and truncations of their posterior axis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality during organogenesis, embryonic growth retardation, caudal body truncation, and severe defects in neural tube development, somitogenesis, cardiogenesis, and vascular remodeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr24 A G 17: 25,826,128 Y279C probably damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Poglut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Poglut1 APN 16 38542916 missense possibly damaging 0.96
R0646:Poglut1 UTSW 16 38529475 missense probably damaging 0.99
R2025:Poglut1 UTSW 16 38537905 critical splice donor site probably null
R2054:Poglut1 UTSW 16 38534807 missense probably damaging 1.00
R4514:Poglut1 UTSW 16 38549416 missense probably benign 0.00
R4770:Poglut1 UTSW 16 38534757 missense probably damaging 1.00
R5649:Poglut1 UTSW 16 38531811 missense probably damaging 0.99
R5893:Poglut1 UTSW 16 38529595 missense probably damaging 0.99
R6796:Poglut1 UTSW 16 38529610 missense probably damaging 1.00
R7404:Poglut1 UTSW 16 38537922 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACCCTGGGAGACAGCGATTTACAC -3'
(R):5'- TGAGCAACCAAGATGCTGCACTAC -3'

Sequencing Primer
(F):5'- GAGACAGCGATTTACACATACG -3'
(R):5'- TTGGCACTAAATGCTGCATAGG -3'
Posted On2013-10-16