Incidental Mutation 'R0799:Wdr24'
ID76556
Institutional Source Beutler Lab
Gene Symbol Wdr24
Ensembl Gene ENSMUSG00000025737
Gene NameWD repeat domain 24
Synonyms
MMRRC Submission 038979-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0799 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25823627-25828730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25826128 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 279 (Y279C)
Ref Sequence ENSEMBL: ENSMUSP00000026833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000045692] [ENSMUST00000123582] [ENSMUST00000133595]
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000026833
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737
AA Change: Y279C

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045692
SMART Domains Protein: ENSMUSP00000048562
Gene: ENSMUSG00000025738

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
Blast:FBOX 98 137 2e-14 BLAST
LRR 241 266 1.32e1 SMART
LRR 267 291 1.61e2 SMART
LRR 293 318 1.76e2 SMART
LRR 319 344 3.21e-4 SMART
LRR 345 370 7.67e-2 SMART
LRR 371 396 6.13e-1 SMART
LRR 421 446 3.52e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123560
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123692
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144589
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Meta Mutation Damage Score 0.7741 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,928,599 M41T probably damaging Het
4921539E11Rik G A 4: 103,242,904 T33I possibly damaging Het
4930555F03Rik A G 8: 49,495,439 noncoding transcript Het
Abcf3 T C 16: 20,559,334 L538P probably damaging Het
Adamts6 T C 13: 104,314,271 S321P probably damaging Het
Adgra2 G A 8: 27,112,495 R362H probably damaging Het
AI597479 T G 1: 43,111,170 S147A probably benign Het
Ampd3 T C 7: 110,800,697 F340L probably damaging Het
Arntl2 T C 6: 146,823,253 probably benign Het
Atad3a A G 4: 155,747,470 V449A probably damaging Het
Bpifa6 A T 2: 153,992,272 D328V probably benign Het
Brca2 T C 5: 150,560,193 S2903P probably damaging Het
Cct3 A T 3: 88,299,345 probably null Het
Cdk4 A G 10: 127,064,994 T172A probably damaging Het
Chd5 A G 4: 152,384,159 D1760G probably damaging Het
Chd7 A G 4: 8,801,310 probably benign Het
Crybb2 T C 5: 113,062,171 I109V probably benign Het
Csmd3 A G 15: 48,185,384 probably benign Het
Dach1 G T 14: 98,168,615 T232K possibly damaging Het
Dnlz A G 2: 26,351,473 V81A possibly damaging Het
Epb41l4b A G 4: 57,086,003 S191P probably damaging Het
Eps15l1 C T 8: 72,346,085 D821N probably damaging Het
Fam186a G A 15: 99,942,012 P2117L probably damaging Het
Fam83d T A 2: 158,779,888 F173Y probably damaging Het
Gm9116 A T 3: 93,910,465 R214S probably benign Het
Gm996 A G 2: 25,578,562 S446P possibly damaging Het
Gtpbp1 A G 15: 79,716,200 I445V probably damaging Het
H2-M2 G A 17: 37,482,749 T122I probably damaging Het
Hgd C T 16: 37,628,609 probably benign Het
Hip1r A G 5: 123,996,941 Y380C probably benign Het
Hspa8 G A 9: 40,803,841 G389R probably damaging Het
Htt C A 5: 34,817,753 D622E probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm4a A G 4: 118,146,992 probably null Het
Map3k9 G A 12: 81,722,269 P1025S probably benign Het
Olfr911-ps1 G A 9: 38,524,141 M136I probably benign Het
Pabpc1l C A 2: 164,031,214 H135N probably benign Het
Pacsin2 A T 15: 83,379,797 S346R probably benign Het
Pcdhb20 A G 18: 37,505,885 Y488C probably damaging Het
Pkdcc G A 17: 83,223,918 C452Y probably damaging Het
Poglut1 T C 16: 38,534,721 probably null Het
Pxk T C 14: 8,148,123 F409L probably benign Het
Pygm G A 19: 6,386,018 probably benign Het
Rabep2 T C 7: 126,438,724 S223P probably damaging Het
Rpp40 C T 13: 35,902,051 R109H probably benign Het
Sbf2 T C 7: 110,341,355 Y1266C possibly damaging Het
Slc5a4a T C 10: 76,176,534 V346A probably benign Het
Smpd3 G T 8: 106,264,789 H377Q possibly damaging Het
Sppl2a C A 2: 126,920,307 probably benign Het
Tas2r134 T C 2: 51,628,373 I288T probably benign Het
Trim35 T A 14: 66,309,201 H472Q probably damaging Het
Trpm5 C A 7: 143,078,351 R907L probably damaging Het
Ube2e2 G T 14: 18,630,393 S56* probably null Het
Vmn2r88 A C 14: 51,414,502 R432S possibly damaging Het
Wdr90 A G 17: 25,860,130 V246A probably benign Het
Xrn2 T A 2: 147,029,898 N385K probably benign Het
Zfp28 T A 7: 6,384,183 S73T possibly damaging Het
Zfp345 T C 2: 150,472,351 E422G probably benign Het
Zhx2 A G 15: 57,821,313 E26G probably benign Het
Other mutations in Wdr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Wdr24 APN 17 25826621 missense probably benign 0.20
IGL01700:Wdr24 APN 17 25825828 missense probably damaging 1.00
IGL01763:Wdr24 APN 17 25826190 missense probably benign 0.20
IGL02567:Wdr24 APN 17 25824348 missense probably damaging 0.99
IGL03100:Wdr24 APN 17 25825707 missense possibly damaging 0.47
R0012:Wdr24 UTSW 17 25827113 missense probably benign
R1015:Wdr24 UTSW 17 25828238 missense probably benign 0.12
R1276:Wdr24 UTSW 17 25827467 missense probably benign 0.02
R1297:Wdr24 UTSW 17 25827348 missense possibly damaging 0.90
R1934:Wdr24 UTSW 17 25824266 missense possibly damaging 0.89
R2030:Wdr24 UTSW 17 25826043 missense probably benign 0.38
R2069:Wdr24 UTSW 17 25826282 missense probably damaging 1.00
R2508:Wdr24 UTSW 17 25824299 missense possibly damaging 0.52
R4601:Wdr24 UTSW 17 25828207 unclassified probably null
R4604:Wdr24 UTSW 17 25828505 missense probably damaging 1.00
R4894:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R5068:Wdr24 UTSW 17 25825779 missense possibly damaging 0.77
R5088:Wdr24 UTSW 17 25828207 unclassified probably null
R5104:Wdr24 UTSW 17 25824591 missense probably damaging 1.00
R5498:Wdr24 UTSW 17 25824561 missense probably damaging 1.00
R5719:Wdr24 UTSW 17 25828340 critical splice donor site probably null
R5892:Wdr24 UTSW 17 25827986 missense probably benign 0.00
R5975:Wdr24 UTSW 17 25827128 missense probably benign 0.37
R6084:Wdr24 UTSW 17 25824530 missense probably damaging 0.99
R6106:Wdr24 UTSW 17 25824605 missense probably benign
R6114:Wdr24 UTSW 17 25824605 missense probably benign
R6116:Wdr24 UTSW 17 25824605 missense probably benign
R6165:Wdr24 UTSW 17 25826421 missense probably benign 0.18
R6175:Wdr24 UTSW 17 25826578 missense probably damaging 1.00
R6331:Wdr24 UTSW 17 25825676 missense possibly damaging 0.61
R6548:Wdr24 UTSW 17 25827925 missense probably damaging 0.99
R6984:Wdr24 UTSW 17 25828235 missense possibly damaging 0.93
R7485:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
R7583:Wdr24 UTSW 17 25825830 missense probably null 1.00
R7770:Wdr24 UTSW 17 25827096 missense probably benign 0.04
R8086:Wdr24 UTSW 17 25826127 missense probably damaging 1.00
X0022:Wdr24 UTSW 17 25824272 missense probably damaging 0.99
Z1177:Wdr24 UTSW 17 25825687 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATGGGAGAGGTCACTGACAGCTTG -3'
(R):5'- CACCAGCATAGGGTTTACGTCCAG -3'

Sequencing Primer
(F):5'- AGCTTGAGTGGGACATTCTCC -3'
(R):5'- GTTTACGTCCAGATTCAGCAG -3'
Posted On2013-10-16