Incidental Mutation 'R0780:Ache'
ID76579
Institutional Source Beutler Lab
Gene Symbol Ache
Ensembl Gene ENSMUSG00000023328
Gene Nameacetylcholinesterase
Synonyms
MMRRC Submission 038960-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R0780 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137287519-137294466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137290532 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 167 (R167C)
Ref Sequence ENSEMBL: ENSMUSP00000083097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000141123] [ENSMUST00000196208]
Predicted Effect probably damaging
Transcript: ENSMUST00000024099
AA Change: R167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: R167C

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085934
AA Change: R167C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: R167C

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125195
Predicted Effect probably benign
Transcript: ENSMUST00000132191
Predicted Effect probably benign
Transcript: ENSMUST00000137126
Predicted Effect probably benign
Transcript: ENSMUST00000138591
Predicted Effect probably benign
Transcript: ENSMUST00000141123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect probably damaging
Transcript: ENSMUST00000196208
AA Change: R167C

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: R167C

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196840
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 T C 12: 87,268,328 I85T probably benign Het
Btaf1 T C 19: 36,988,922 L1030S probably damaging Het
Ccdc163 A G 4: 116,712,407 K222E probably benign Het
Cpsf1 A G 15: 76,600,377 F635L probably benign Het
Cubn G A 2: 13,456,613 T701M probably damaging Het
Cxcr2 T A 1: 74,159,175 M276K probably damaging Het
Daam1 T A 12: 71,947,050 I409K unknown Het
Dnah10 G T 5: 124,750,812 G741W possibly damaging Het
Ica1l A G 1: 59,997,449 probably null Het
Ifi208 A G 1: 173,682,696 D139G probably benign Het
Kat2b T A 17: 53,567,448 V40E unknown Het
Kmt2d G T 15: 98,862,857 P871T unknown Het
Lats2 A T 14: 57,691,296 Y1041N probably damaging Het
Lifr C T 15: 7,177,466 T486I probably benign Het
Mtmr4 T A 11: 87,611,440 D773E probably benign Het
Ptgds A G 2: 25,468,092 F143S possibly damaging Het
Rp1l1 A G 14: 64,030,351 S1129G possibly damaging Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Slc12a8 G A 16: 33,646,665 probably null Het
Thsd7a A G 6: 12,337,274 V1248A probably damaging Het
Tpr T A 1: 150,431,341 H1562Q probably benign Het
Uba3 G A 6: 97,186,705 R294* probably null Het
Vmn2r22 A T 6: 123,637,974 V219E probably damaging Het
Zfand6 T A 7: 84,615,834 I220F probably damaging Het
Other mutations in Ache
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Ache APN 5 137291064 missense probably damaging 1.00
IGL02833:Ache APN 5 137291109 unclassified probably benign
R0058:Ache UTSW 5 137290842 missense probably damaging 1.00
R0358:Ache UTSW 5 137290373 missense probably benign 0.21
R0377:Ache UTSW 5 137290928 missense possibly damaging 0.54
R1233:Ache UTSW 5 137290157 unclassified probably null
R1702:Ache UTSW 5 137290989 missense possibly damaging 0.94
R1762:Ache UTSW 5 137290575 missense possibly damaging 0.91
R4191:Ache UTSW 5 137291072 missense probably damaging 0.98
R4226:Ache UTSW 5 137290890 missense possibly damaging 0.83
R4499:Ache UTSW 5 137291932 missense probably damaging 0.98
R4931:Ache UTSW 5 137291914 missense probably benign 0.00
R5411:Ache UTSW 5 137290064 missense possibly damaging 0.93
R5411:Ache UTSW 5 137290430 unclassified probably null
R5698:Ache UTSW 5 137290559 missense probably damaging 1.00
R6153:Ache UTSW 5 137291855 missense probably damaging 1.00
R6526:Ache UTSW 5 137290644 missense probably damaging 1.00
R6896:Ache UTSW 5 137291734 missense probably damaging 0.98
R6981:Ache UTSW 5 137291678 missense probably benign
R7199:Ache UTSW 5 137290242 missense probably damaging 1.00
R7208:Ache UTSW 5 137291489 missense probably damaging 1.00
X0061:Ache UTSW 5 137290095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACCACCTTCCAAAATGTCTGC -3'
(R):5'- CAAACAGAGTCACTGACATCGGGTC -3'

Sequencing Primer
(F):5'- TCTGCTACCAGTACGTGGAC -3'
(R):5'- CGTTGATCCAGCAGACCTACATT -3'
Posted On2013-10-16