Incidental Mutation 'R0780:Daam1'
ID76587
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 038960-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0780 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71947050 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 409 (I409K)
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect unknown
Transcript: ENSMUST00000085299
AA Change: I409K
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: I409K

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221317
AA Change: I409K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222327
Predicted Effect unknown
Transcript: ENSMUST00000223272
AA Change: I409K
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache C T 5: 137,290,532 R167C probably damaging Het
Ahsa1 T C 12: 87,268,328 I85T probably benign Het
Btaf1 T C 19: 36,988,922 L1030S probably damaging Het
Ccdc163 A G 4: 116,712,407 K222E probably benign Het
Cpsf1 A G 15: 76,600,377 F635L probably benign Het
Cubn G A 2: 13,456,613 T701M probably damaging Het
Cxcr2 T A 1: 74,159,175 M276K probably damaging Het
Dnah10 G T 5: 124,750,812 G741W possibly damaging Het
Ica1l A G 1: 59,997,449 probably null Het
Ifi208 A G 1: 173,682,696 D139G probably benign Het
Kat2b T A 17: 53,567,448 V40E unknown Het
Kmt2d G T 15: 98,862,857 P871T unknown Het
Lats2 A T 14: 57,691,296 Y1041N probably damaging Het
Lifr C T 15: 7,177,466 T486I probably benign Het
Mtmr4 T A 11: 87,611,440 D773E probably benign Het
Ptgds A G 2: 25,468,092 F143S possibly damaging Het
Rp1l1 A G 14: 64,030,351 S1129G possibly damaging Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Slc12a8 G A 16: 33,646,665 probably null Het
Thsd7a A G 6: 12,337,274 V1248A probably damaging Het
Tpr T A 1: 150,431,341 H1562Q probably benign Het
Uba3 G A 6: 97,186,705 R294* probably null Het
Vmn2r22 A T 6: 123,637,974 V219E probably damaging Het
Zfand6 T A 7: 84,615,834 I220F probably damaging Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGTGTCCAAAGCGCATACTC -3'
(R):5'- TGACCCCTAGAACCATTCATCTGGC -3'

Sequencing Primer
(F):5'- GTTTCCTCACAGATTAAGGGCAG -3'
(R):5'- GCCCCGCTGTTATTTGAGG -3'
Posted On2013-10-16