Incidental Mutation 'R0780:Ahsa1'
ID76588
Institutional Source Beutler Lab
Gene Symbol Ahsa1
Ensembl Gene ENSMUSG00000021037
Gene NameAHA1, activator of heat shock protein ATPase 1
SynonymsAha1, p38
MMRRC Submission 038960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0780 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87266479-87273998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87268328 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 85 (I85T)
Ref Sequence ENSEMBL: ENSMUSP00000021425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021425] [ENSMUST00000021426] [ENSMUST00000072744] [ENSMUST00000179379] [ENSMUST00000223352]
Predicted Effect probably benign
Transcript: ENSMUST00000021425
AA Change: I85T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021425
Gene: ENSMUSG00000021037
AA Change: I85T

DomainStartEndE-ValueType
Aha1_N 29 161 1.16e-56 SMART
low complexity region 187 199 N/A INTRINSIC
Pfam:AHSA1 216 332 2.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021426
SMART Domains Protein: ENSMUSP00000021426
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072744
SMART Domains Protein: ENSMUSP00000072527
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 489 3.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179379
SMART Domains Protein: ENSMUSP00000137190
Gene: ENSMUSG00000021038

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223239
Predicted Effect probably benign
Transcript: ENSMUST00000223352
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache C T 5: 137,290,532 R167C probably damaging Het
Btaf1 T C 19: 36,988,922 L1030S probably damaging Het
Ccdc163 A G 4: 116,712,407 K222E probably benign Het
Cpsf1 A G 15: 76,600,377 F635L probably benign Het
Cubn G A 2: 13,456,613 T701M probably damaging Het
Cxcr2 T A 1: 74,159,175 M276K probably damaging Het
Daam1 T A 12: 71,947,050 I409K unknown Het
Dnah10 G T 5: 124,750,812 G741W possibly damaging Het
Ica1l A G 1: 59,997,449 probably null Het
Ifi208 A G 1: 173,682,696 D139G probably benign Het
Kat2b T A 17: 53,567,448 V40E unknown Het
Kmt2d G T 15: 98,862,857 P871T unknown Het
Lats2 A T 14: 57,691,296 Y1041N probably damaging Het
Lifr C T 15: 7,177,466 T486I probably benign Het
Mtmr4 T A 11: 87,611,440 D773E probably benign Het
Ptgds A G 2: 25,468,092 F143S possibly damaging Het
Rp1l1 A G 14: 64,030,351 S1129G possibly damaging Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Slc12a8 G A 16: 33,646,665 probably null Het
Thsd7a A G 6: 12,337,274 V1248A probably damaging Het
Tpr T A 1: 150,431,341 H1562Q probably benign Het
Uba3 G A 6: 97,186,705 R294* probably null Het
Vmn2r22 A T 6: 123,637,974 V219E probably damaging Het
Zfand6 T A 7: 84,615,834 I220F probably damaging Het
Other mutations in Ahsa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4817:Ahsa1 UTSW 12 87273166 missense possibly damaging 0.83
R7021:Ahsa1 UTSW 12 87271380 missense possibly damaging 0.77
R7133:Ahsa1 UTSW 12 87270342 missense probably benign 0.00
R7437:Ahsa1 UTSW 12 87268156 missense probably damaging 1.00
V8831:Ahsa1 UTSW 12 87269923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGCAGTCACCTGCTGAATG -3'
(R):5'- TGCCGCTTGCCTTCAAAGCAAC -3'

Sequencing Primer
(F):5'- CTGAATGAAACAGTGCGTTCTCC -3'
(R):5'- TTCAAAGCAACACCGTCTTCTC -3'
Posted On2013-10-16