Incidental Mutation 'R0780:Kat2b'
ID76596
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 038960-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0780 (G1)
Quality Score97
Status Not validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53567448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 40 (V40E)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724]
Predicted Effect unknown
Transcript: ENSMUST00000000724
AA Change: V40E
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: V40E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163648
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache C T 5: 137,290,532 R167C probably damaging Het
Ahsa1 T C 12: 87,268,328 I85T probably benign Het
Btaf1 T C 19: 36,988,922 L1030S probably damaging Het
Ccdc163 A G 4: 116,712,407 K222E probably benign Het
Cpsf1 A G 15: 76,600,377 F635L probably benign Het
Cubn G A 2: 13,456,613 T701M probably damaging Het
Cxcr2 T A 1: 74,159,175 M276K probably damaging Het
Daam1 T A 12: 71,947,050 I409K unknown Het
Dnah10 G T 5: 124,750,812 G741W possibly damaging Het
Ica1l A G 1: 59,997,449 probably null Het
Ifi208 A G 1: 173,682,696 D139G probably benign Het
Kmt2d G T 15: 98,862,857 P871T unknown Het
Lats2 A T 14: 57,691,296 Y1041N probably damaging Het
Lifr C T 15: 7,177,466 T486I probably benign Het
Mtmr4 T A 11: 87,611,440 D773E probably benign Het
Ptgds A G 2: 25,468,092 F143S possibly damaging Het
Rp1l1 A G 14: 64,030,351 S1129G possibly damaging Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Slc12a8 G A 16: 33,646,665 probably null Het
Thsd7a A G 6: 12,337,274 V1248A probably damaging Het
Tpr T A 1: 150,431,341 H1562Q probably benign Het
Uba3 G A 6: 97,186,705 R294* probably null Het
Vmn2r22 A T 6: 123,637,974 V219E probably damaging Het
Zfand6 T A 7: 84,615,834 I220F probably damaging Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
R8250:Kat2b UTSW 17 53663536 missense probably damaging 1.00
R8277:Kat2b UTSW 17 53641253 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCGCTAGGGTGGAGGAAGTT -3'
(R):5'- CCAGTGAGATGCTGTGCAAGCC -3'

Sequencing Primer
(F):5'- CTAGCGTCCTAGCCGCC -3'
(R):5'- GAACGCAGCACTTCCGC -3'
Posted On2013-10-16