Mutagenetix > Incidental Mutations

Incidental Mutation 'R0781:Cntn3'

76622

Institutional Source

Beutler Lab

Gene Symbol

Cntn3

Ensembl Gene

ENSMUSG00000030075

Gene Name

contactin 3

Synonyms

Pang

MMRRC Submission

038961-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0781 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102162655-102573101 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102245158 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 460 (N460I)

Ref Sequence

ENSEMBL: ENSMUSP00000145176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]

Predicted Effect

probably benign
Transcript: ENSMUST00000032159
AA Change: N460I

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: N460I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203619
AA Change: N460I

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: N460I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Meta Mutation Damage Score

0.1028

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.0%
20x: 93.2%

Validation Efficiency

97% (67/69)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	G	T	17: 79,627,751	A98S	probably benign	Het
Acp2	A	G	2: 91,208,422		probably null	Het
Akap13	T	G	7: 75,611,377	S447A	possibly damaging	Het
Alk	G	A	17: 71,984,745		probably benign	Het
Ankrd55	A	G	13: 112,381,233		probably benign	Het
Arhgef39	T	C	4: 43,496,834	T327A	probably benign	Het
Cdan1	G	A	2: 120,720,602	A1103V	probably damaging	Het
Cdk17	T	A	10: 93,239,033	Y3*	probably null	Het
Cdon	T	C	9: 35,456,437		probably benign	Het
Cntrl	T	A	2: 35,160,627	C985S	possibly damaging	Het
Col6a2	T	C	10: 76,607,740	E497G	probably benign	Het
Crybg1	A	G	10: 43,999,093	M673T	possibly damaging	Het
Csmd1	A	C	8: 15,921,174	I3047S	probably benign	Het
Cyp2u1	A	G	3: 131,293,609	I441T	possibly damaging	Het
Disp2	T	C	2: 118,790,439	S551P	probably damaging	Het
Dstyk	A	G	1: 132,453,325		probably benign	Het
Fam26e	T	G	10: 34,096,017	I141L	probably benign	Het
Frem1	T	C	4: 82,950,320	S1457G	probably damaging	Het
Gabbr2	C	T	4: 46,718,838	C613Y	probably damaging	Het
Gdf7	C	A	12: 8,301,555		probably benign	Het
Gm906	A	T	13: 50,248,260	D83E	possibly damaging	Het
Hnrnpul2	A	G	19: 8,826,746	R570G	probably damaging	Het
Iqcf4	T	C	9: 106,568,661	I96V	probably benign	Het
Iqck	G	A	7: 118,899,657	D173N	possibly damaging	Het
Itpr3	C	T	17: 27,110,555	H1518Y	probably benign	Het
Kdm5d	T	A	Y: 910,539	L250H	probably damaging	Het
Kntc1	C	T	5: 123,799,902		probably benign	Het
Lmtk3	T	A	7: 45,795,003		probably benign	Het
Lpin3	A	G	2: 160,894,079	D93G	probably benign	Het
Ncoa6	A	T	2: 155,411,520		probably benign	Het
Nudt7	G	A	8: 114,135,371		probably benign	Het
Nup160	A	G	2: 90,733,219		probably benign	Het
Oit3	G	A	10: 59,428,194	R373C	probably damaging	Het
Olfml2a	A	T	2: 38,959,753	I494L	probably damaging	Het
Olfr194	A	T	16: 59,119,824	V82D	probably damaging	Het
Olfr78	A	G	7: 102,743,007		probably benign	Het
Olfr824	A	G	10: 130,126,653	Y135H	probably damaging	Het
Opa3	A	G	7: 19,228,599		probably benign	Het
Pak3	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	X: 143,743,893		probably benign	Het
Parp6	G	T	9: 59,649,564	C584F	probably damaging	Het
Pcgf2	A	G	11: 97,691,850		probably benign	Het
Pde3a	T	C	6: 141,459,316		probably benign	Het
Pitrm1	A	G	13: 6,558,244	D335G	probably benign	Het
Pkhd1	A	T	1: 20,117,484	N3533K	probably benign	Het
Pkp4	T	C	2: 59,338,765	L752P	probably damaging	Het
Plcb3	C	A	19: 6,961,913	E566*	probably null	Het
Ppef2	T	C	5: 92,244,830	K261R	probably benign	Het
Prdm14	A	G	1: 13,114,361	S529P	probably damaging	Het
Prune2	T	C	19: 17,125,222	S2582P	probably benign	Het
Sardh	G	A	2: 27,191,919	T865I	possibly damaging	Het
Slc26a3	A	T	12: 31,465,813	I571F	possibly damaging	Het
Slc5a5	A	T	8: 70,890,220	M232K	probably benign	Het
Slc9a1	T	A	4: 133,370,548	M2K	probably benign	Het
Ss18l1	G	A	2: 180,055,854	S177N	possibly damaging	Het
Svs5	A	T	2: 164,333,587	I120L	probably benign	Het
Tcl1b1	G	T	12: 105,159,815	V19F	probably damaging	Het
Tmem108	C	T	9: 103,484,690	V566M	probably damaging	Het
Trmu	C	A	15: 85,879,403	C9*	probably null	Het
Ttc30a1	A	T	2: 75,979,976	C588S	probably damaging	Het
Vnn1	A	T	10: 23,899,601	I250F	possibly damaging	Het
Vps13c	T	A	9: 67,972,003	Y3409N	probably damaging	Het
Xrn1	T	A	9: 95,991,269	N695K	probably benign	Het
Zfp84	T	A	7: 29,771,372	M1K	probably null	Het
Zfyve26	G	A	12: 79,280,067	R761C	probably damaging	Het
Zp3r	A	G	1: 130,577,884		probably null	Het

Other mutations in Cntn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Cntn3	APN	6	102420262	nonsense	probably null
IGL00706:Cntn3	APN	6	102203949	missense	probably benign	0.11
IGL01071:Cntn3	APN	6	102420251	critical splice donor site	probably null
IGL01769:Cntn3	APN	6	102208184	missense	probably damaging	1.00
IGL01995:Cntn3	APN	6	102203885	missense	probably damaging	1.00
IGL02058:Cntn3	APN	6	102199360	splice site	probably benign
IGL02736:Cntn3	APN	6	102203939	missense	probably damaging	1.00
IGL02955:Cntn3	APN	6	102278301	missense	probably damaging	1.00
IGL02971:Cntn3	APN	6	102168933	missense	probably damaging	1.00
IGL03208:Cntn3	APN	6	102187099	missense	probably damaging	0.99
P0037:Cntn3	UTSW	6	102209274	missense	probably damaging	1.00
PIT4431001:Cntn3	UTSW	6	102464566	missense	probably benign	0.22
R0314:Cntn3	UTSW	6	102420381	missense	probably damaging	1.00
R0388:Cntn3	UTSW	6	102277316	missense	probably damaging	0.96
R0483:Cntn3	UTSW	6	102203966	missense	probably damaging	1.00
R0539:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R0543:Cntn3	UTSW	6	102269090	splice site	probably benign
R0629:Cntn3	UTSW	6	102203976	missense	probably damaging	1.00
R0691:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0693:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R1110:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1144:Cntn3	UTSW	6	102242126	missense	possibly damaging	0.65
R1503:Cntn3	UTSW	6	102464565	nonsense	probably null
R1640:Cntn3	UTSW	6	102242013	missense	possibly damaging	0.82
R1681:Cntn3	UTSW	6	102170668	missense	probably damaging	1.00
R1770:Cntn3	UTSW	6	102269205	missense	possibly damaging	0.49
R1782:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R1861:Cntn3	UTSW	6	102245071	missense	probably benign	0.11
R1930:Cntn3	UTSW	6	102242053	nonsense	probably null
R2026:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R2152:Cntn3	UTSW	6	102206537	missense	probably damaging	1.00
R2313:Cntn3	UTSW	6	102203928	missense	probably benign
R2351:Cntn3	UTSW	6	102337383	missense	possibly damaging	0.55
R3611:Cntn3	UTSW	6	102208077	missense	possibly damaging	0.77
R4349:Cntn3	UTSW	6	102199351	missense	probably damaging	1.00
R4421:Cntn3	UTSW	6	102464547	missense	probably damaging	0.97
R4513:Cntn3	UTSW	6	102168982	missense	probably benign	0.37
R4678:Cntn3	UTSW	6	102204020	missense	probably damaging	1.00
R4702:Cntn3	UTSW	6	102165331	missense	probably benign	0.37
R4720:Cntn3	UTSW	6	102242022	missense	possibly damaging	0.65
R4879:Cntn3	UTSW	6	102267428	missense	possibly damaging	0.47
R4951:Cntn3	UTSW	6	102169025	missense	possibly damaging	0.90
R5410:Cntn3	UTSW	6	102278353	missense	probably benign	0.01
R5502:Cntn3	UTSW	6	102265334	missense	possibly damaging	0.58
R5852:Cntn3	UTSW	6	102420416	missense	probably damaging	1.00
R5903:Cntn3	UTSW	6	102242133	missense	probably benign	0.00
R6193:Cntn3	UTSW	6	102208131	missense	probably benign	0.31
R6258:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6260:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6350:Cntn3	UTSW	6	102170618	missense	probably damaging	1.00
R6490:Cntn3	UTSW	6	102278340	missense	probably damaging	0.99
R6993:Cntn3	UTSW	6	102278404	missense	probably damaging	0.98
R7064:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R7085:Cntn3	UTSW	6	102165401	missense	possibly damaging	0.85
R7174:Cntn3	UTSW	6	102165344	missense	probably benign
R7208:Cntn3	UTSW	6	102278422	nonsense	probably null
R7395:Cntn3	UTSW	6	102337394	critical splice acceptor site	probably null
R7447:Cntn3	UTSW	6	102278455	nonsense	probably null
R7571:Cntn3	UTSW	6	102278403	missense	probably damaging	1.00
R7586:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R7614:Cntn3	UTSW	6	102165376	missense	probably benign	0.17
R7697:Cntn3	UTSW	6	102208166	missense	probably damaging	1.00
R7697:Cntn3	UTSW	6	102208167	missense	probably damaging	1.00
R7849:Cntn3	UTSW	6	102265431	missense	probably benign	0.00
R7932:Cntn3	UTSW	6	102265431	missense	probably benign	0.00
R8011:Cntn3	UTSW	6	102437899	missense	possibly damaging	0.93
R8013:Cntn3	UTSW	6	102199317	missense	probably benign	0.00
Z1088:Cntn3	UTSW	6	102420294	missense	possibly damaging	0.74
Z1176:Cntn3	UTSW	6	102437931	critical splice acceptor site	probably null
Z1177:Cntn3	UTSW	6	102337331	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GTGTGTACTATGCAGTGGGAGAGACA -3'
(R):5'- GCCACCCCTATGGAGTGACTGA -3'

Sequencing Primer
(F):5'- TAAACATGCCTAGTCTACCTAGTGC -3'
(R):5'- CTTTTTAGTACCTCACAGATGACC -3'

Posted On

2013-10-16