Incidental Mutation 'R0781:Ankrd55'
ID76652
Institutional Source Beutler Lab
Gene Symbol Ankrd55
Ensembl Gene ENSMUSG00000049985
Gene Nameankyrin repeat domain 55
SynonymsC030011J08Rik
MMRRC Submission 038961-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0781 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112288451-112384002 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 112381233 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022275] [ENSMUST00000165593]
Predicted Effect probably benign
Transcript: ENSMUST00000022275
SMART Domains Protein: ENSMUSP00000022275
Gene: ENSMUSG00000049985

DomainStartEndE-ValueType
Blast:ANK 25 54 1e-9 BLAST
ANK 59 88 7.64e-6 SMART
ANK 92 121 4.18e2 SMART
ANK 125 156 4.86e1 SMART
ANK 160 189 5.32e-5 SMART
ANK 193 222 7.59e-1 SMART
ANK 229 257 2.97e2 SMART
ANK 263 292 5.71e-5 SMART
ANK 296 326 1.63e0 SMART
low complexity region 528 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165593
SMART Domains Protein: ENSMUSP00000126199
Gene: ENSMUSG00000049985

DomainStartEndE-ValueType
Blast:ANK 1 26 8e-8 BLAST
ANK 31 60 7.64e-6 SMART
ANK 64 93 4.18e2 SMART
ANK 97 128 4.86e1 SMART
ANK 132 161 5.32e-5 SMART
ANK 165 194 7.59e-1 SMART
ANK 201 229 2.97e2 SMART
ANK 235 264 5.71e-5 SMART
ANK 268 298 1.63e0 SMART
low complexity region 500 515 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.2%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G T 17: 79,627,751 A98S probably benign Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Csmd1 A C 8: 15,921,174 I3047S probably benign Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gdf7 C A 12: 8,301,555 probably benign Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Iqcf4 T C 9: 106,568,661 I96V probably benign Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Itpr3 C T 17: 27,110,555 H1518Y probably benign Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kntc1 C T 5: 123,799,902 probably benign Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nudt7 G A 8: 114,135,371 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr194 A T 16: 59,119,824 V82D probably damaging Het
Olfr78 A G 7: 102,743,007 probably benign Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Opa3 A G 7: 19,228,599 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkhd1 A T 1: 20,117,484 N3533K probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Ppef2 T C 5: 92,244,830 K261R probably benign Het
Prdm14 A G 1: 13,114,361 S529P probably damaging Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Slc26a3 A T 12: 31,465,813 I571F possibly damaging Het
Slc5a5 A T 8: 70,890,220 M232K probably benign Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Ss18l1 G A 2: 180,055,854 S177N possibly damaging Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Tmem108 C T 9: 103,484,690 V566M probably damaging Het
Trmu C A 15: 85,879,403 C9* probably null Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Vps13c T A 9: 67,972,003 Y3409N probably damaging Het
Xrn1 T A 9: 95,991,269 N695K probably benign Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Ankrd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ankrd55 APN 13 112367794 missense probably benign 0.01
IGL01372:Ankrd55 APN 13 112323143 missense probably damaging 1.00
IGL01554:Ankrd55 APN 13 112323067 missense possibly damaging 0.87
IGL01700:Ankrd55 APN 13 112381168 missense probably benign 0.16
IGL02366:Ankrd55 APN 13 112318460 missense probably damaging 1.00
IGL03368:Ankrd55 APN 13 112318556 splice site probably benign
crescat UTSW 13 112348863 critical splice donor site probably null
I0000:Ankrd55 UTSW 13 112348725 splice site probably benign
R0547:Ankrd55 UTSW 13 112368223 missense probably benign 0.03
R0981:Ankrd55 UTSW 13 112323076 missense possibly damaging 0.78
R1072:Ankrd55 UTSW 13 112348842 missense possibly damaging 0.83
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R1469:Ankrd55 UTSW 13 112367926 missense probably benign 0.39
R2187:Ankrd55 UTSW 13 112383505 missense probably benign 0.01
R4430:Ankrd55 UTSW 13 112323183 critical splice donor site probably null
R4753:Ankrd55 UTSW 13 112363475 missense probably benign
R4846:Ankrd55 UTSW 13 112363454 missense probably benign 0.00
R4911:Ankrd55 UTSW 13 112323039 splice site probably null
R4996:Ankrd55 UTSW 13 112356088 missense possibly damaging 0.68
R5007:Ankrd55 UTSW 13 112367932 missense probably benign
R5077:Ankrd55 UTSW 13 112355988 missense probably benign 0.19
R5118:Ankrd55 UTSW 13 112355939 missense probably benign 0.00
R5350:Ankrd55 UTSW 13 112336226 missense probably damaging 1.00
R5367:Ankrd55 UTSW 13 112318502 missense probably damaging 1.00
R5560:Ankrd55 UTSW 13 112383490 missense probably benign
R5888:Ankrd55 UTSW 13 112355919 missense possibly damaging 0.62
R6130:Ankrd55 UTSW 13 112318446 missense probably damaging 1.00
R6589:Ankrd55 UTSW 13 112348863 critical splice donor site probably null
R6994:Ankrd55 UTSW 13 112368300 missense probably benign 0.42
R7100:Ankrd55 UTSW 13 112356110 missense probably benign 0.00
R7247:Ankrd55 UTSW 13 112336253 missense probably damaging 0.97
R7340:Ankrd55 UTSW 13 112355963 missense probably damaging 0.99
R7694:Ankrd55 UTSW 13 112367964 missense probably damaging 1.00
R8053:Ankrd55 UTSW 13 112323153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGTAGCCCATGCCTAAGACA -3'
(R):5'- GGCCAAATAAGCTCCTGCTATTGTGT -3'

Sequencing Primer
(F):5'- cacacacacacacacacacC -3'
(R):5'- TCAAACAAAATTCCCTGAAGTGG -3'
Posted On2013-10-16