Incidental Mutation 'R0781:Plcb3'
ID76657
Institutional Source Beutler Lab
Gene Symbol Plcb3
Ensembl Gene ENSMUSG00000024960
Gene Namephospholipase C, beta 3
Synonyms
MMRRC Submission 038961-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R0781 (G1)
Quality Score178
Status Validated
Chromosome19
Chromosomal Location6953714-6969759 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 6961913 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 566 (E566*)
Ref Sequence ENSEMBL: ENSMUSP00000025912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025912]
Predicted Effect probably null
Transcript: ENSMUST00000025912
AA Change: E566*
SMART Domains Protein: ENSMUSP00000025912
Gene: ENSMUSG00000024960
AA Change: E566*

DomainStartEndE-ValueType
Pfam:EF-hand_like 225 316 6.6e-23 PFAM
PLCXc 317 468 4.26e-73 SMART
low complexity region 488 515 N/A INTRINSIC
low complexity region 553 578 N/A INTRINSIC
PLCYc 591 707 3.88e-76 SMART
C2 728 826 4.52e-14 SMART
low complexity region 917 936 N/A INTRINSIC
Pfam:PLC-beta_C 1029 1202 5.5e-57 PFAM
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.2%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphoinositide phospholipase C beta enzyme family that catalyze the production of the secondary messengers diacylglycerol and inositol 1,4,5-triphosphate from phosphatidylinositol in G-protein-linked receptor-mediated signal transduction. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one targeted mutation die at E2.5 and exhibit poor embryonic organization and hypocellularity. Mice homozygous for a second targeted mutation survive to adulthood and exhibit an increased antinocieptive response to opioids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G T 17: 79,627,751 A98S probably benign Het
Acp2 A G 2: 91,208,422 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Ankrd55 A G 13: 112,381,233 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Csmd1 A C 8: 15,921,174 I3047S probably benign Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gdf7 C A 12: 8,301,555 probably benign Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Iqcf4 T C 9: 106,568,661 I96V probably benign Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Itpr3 C T 17: 27,110,555 H1518Y probably benign Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kntc1 C T 5: 123,799,902 probably benign Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nudt7 G A 8: 114,135,371 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr194 A T 16: 59,119,824 V82D probably damaging Het
Olfr78 A G 7: 102,743,007 probably benign Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Opa3 A G 7: 19,228,599 probably benign Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkhd1 A T 1: 20,117,484 N3533K probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Ppef2 T C 5: 92,244,830 K261R probably benign Het
Prdm14 A G 1: 13,114,361 S529P probably damaging Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Slc26a3 A T 12: 31,465,813 I571F possibly damaging Het
Slc5a5 A T 8: 70,890,220 M232K probably benign Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Ss18l1 G A 2: 180,055,854 S177N possibly damaging Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Tmem108 C T 9: 103,484,690 V566M probably damaging Het
Trmu C A 15: 85,879,403 C9* probably null Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Vps13c T A 9: 67,972,003 Y3409N probably damaging Het
Xrn1 T A 9: 95,991,269 N695K probably benign Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Plcb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Plcb3 APN 19 6955322 missense probably benign 0.27
IGL01370:Plcb3 APN 19 6962824 missense probably damaging 0.99
IGL01385:Plcb3 APN 19 6957908 missense probably benign
IGL01511:Plcb3 APN 19 6955843 missense probably damaging 0.99
IGL02182:Plcb3 APN 19 6969620 missense probably benign 0.22
IGL02240:Plcb3 APN 19 6958080 splice site probably benign
IGL02350:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02357:Plcb3 APN 19 6958178 missense probably damaging 1.00
IGL02550:Plcb3 APN 19 6960176 nonsense probably null
IGL02866:Plcb3 APN 19 6957676 missense probably damaging 1.00
IGL03180:Plcb3 APN 19 6956153 missense probably benign 0.44
IGL03327:Plcb3 APN 19 6955052 missense probably benign
IGL03346:Plcb3 APN 19 6955052 missense probably benign
Multifarious UTSW 19 6954703 critical splice donor site probably null
R0042:Plcb3 UTSW 19 6966420 missense probably damaging 1.00
R0125:Plcb3 UTSW 19 6958908 missense probably damaging 1.00
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0240:Plcb3 UTSW 19 6962995 missense probably benign 0.16
R0724:Plcb3 UTSW 19 6963392 missense probably damaging 1.00
R0945:Plcb3 UTSW 19 6954878 missense probably damaging 1.00
R1110:Plcb3 UTSW 19 6961913 nonsense probably null
R1414:Plcb3 UTSW 19 6963017 missense probably damaging 1.00
R1454:Plcb3 UTSW 19 6955046 missense possibly damaging 0.64
R1533:Plcb3 UTSW 19 6957673 missense possibly damaging 0.70
R1652:Plcb3 UTSW 19 6955296 missense probably benign 0.00
R1795:Plcb3 UTSW 19 6956013 unclassified probably benign
R1870:Plcb3 UTSW 19 6962985 missense probably benign 0.04
R1934:Plcb3 UTSW 19 6964609 missense probably damaging 1.00
R3980:Plcb3 UTSW 19 6966435 missense probably damaging 1.00
R4397:Plcb3 UTSW 19 6965825 missense probably damaging 0.96
R4533:Plcb3 UTSW 19 6956272 missense probably benign 0.08
R4576:Plcb3 UTSW 19 6959047 splice site probably benign
R4815:Plcb3 UTSW 19 6962984 missense possibly damaging 0.59
R4903:Plcb3 UTSW 19 6955843 missense probably damaging 0.99
R5093:Plcb3 UTSW 19 6966210 missense probably damaging 1.00
R5555:Plcb3 UTSW 19 6966219 missense probably benign 0.19
R5593:Plcb3 UTSW 19 6954749 missense possibly damaging 0.94
R5626:Plcb3 UTSW 19 6955275 missense probably benign 0.24
R5661:Plcb3 UTSW 19 6963220 missense probably damaging 1.00
R5713:Plcb3 UTSW 19 6957692 missense probably damaging 0.99
R5741:Plcb3 UTSW 19 6954422 nonsense probably null
R6025:Plcb3 UTSW 19 6956179 missense probably benign 0.03
R6063:Plcb3 UTSW 19 6962834 missense possibly damaging 0.69
R6155:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6157:Plcb3 UTSW 19 6966165 missense probably damaging 1.00
R6178:Plcb3 UTSW 19 6954703 critical splice donor site probably null
R7085:Plcb3 UTSW 19 6960133 missense possibly damaging 0.80
R7117:Plcb3 UTSW 19 6964378 missense probably damaging 1.00
R7134:Plcb3 UTSW 19 6965330 missense probably damaging 1.00
R7153:Plcb3 UTSW 19 6958084 critical splice donor site probably null
R7316:Plcb3 UTSW 19 6966385 critical splice donor site probably null
R7366:Plcb3 UTSW 19 6962021 missense probably benign
R7399:Plcb3 UTSW 19 6962867 missense probably benign
R7736:Plcb3 UTSW 19 6969623 missense probably benign 0.00
R8057:Plcb3 UTSW 19 6955095 missense probably benign
R8057:Plcb3 UTSW 19 6958899 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATATCTGCATAAACTGGAGCCTG -3'
(R):5'- CTGAGCCCAACTTGTAGTTCTGCC -3'

Sequencing Primer
(F):5'- CTGGAGCCTGCATCAATTAAG -3'
(R):5'- TTCTTGAAGAGGGCACCCTG -3'
Posted On2013-10-16